Labshake search
Citations for Promega :
151 - 200 of 5107 citations for Rat Protein Glutamine Gamma Glutamyltransferase 2 TGM2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Magne Protein G beads (Promega) were used to purify the antibodies according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... In vitro translated proteins (Promega SP6-TNT Quick rabbit reticulocyte lysate system ...
-
bioRxiv - Cancer Biology 2022Quote: ... A BCA protein assay (Promega) was used to determine protein concentration ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HiBiT control protein (#N301A, Promega) dilutions were prepared in the same medium and added (10 µl/well) ...
-
Pushed to the edge: hundreds of Myosin 10s pack into filopodia and could cause traffic jams on actinbioRxiv - Cell Biology 2023Quote: ... Halo Standard Protein (Promega, G4491) samples were prepared for final masses of 1 ng ...
-
bioRxiv - Biochemistry 2023Quote: ... with purified LgBiT Protein (Promega). Briefly ...
-
bioRxiv - Biophysics 2023Quote: ... Protein samples were trypsinized (Promega) in 40mM ammonium bicarbonate (FISHER SCIENTIFIC) ...
-
bioRxiv - Microbiology 2021Quote: ... PA) and AccuMap™ low pH protein digestion kit (with trypsin and lysC) and chymotrypsin (sequencing grade) were from Promega (Madison, WI). PreScisson protease was from GenScript (Piscataway ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were either treated with 50ng/ml rat Nerve Growth Factor (NG; Promega, Madison, WI, USA) at 0 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates were prepared by addition of 0.3N hydrochloric acid then 450nM Tris (pH=8) and metabolites were analyzed using the Glutamine/Glutamate Glo Assay (Promega; J8021) per manufacturer’s instruction.
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples (about 20 μg of protein) were digested with 500 ng of trypsin (Promega) and peptides were analysed by an Ekspert nanoLC 42 nanoflow system (Eksigent Technologies ...
-
bioRxiv - Biochemistry 2021Quote: The kinase activity of the FLT3-ITD protein was measured by using ADP-Glo™ Kinase Assay Kit (Promega, Madison, Wisconsin, the US). Briefly ...
-
bioRxiv - Neuroscience 2019Quote: CHO-K1 cells (ATCC, cultured as described above) were transfected with rat TRAAK-GFP with FugeneHD (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1X sample buffer (4X stock ...
-
bioRxiv - Cancer Biology 2022Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1 X sample buffer (4 X stock ...
-
bioRxiv - Cell Biology 2022Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1X sample buffer (4X stock ...
-
bioRxiv - Plant Biology 2023Quote: ... proteins were co-expressed using TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein G magnetic beads (Promega; G7471) were washed with PBS buffer and then added to the supernatant in a 1:10 volumetric ratio ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was digested by trypsin (Promega) at a ratio of 1:50 (trypsin:protein ...
-
bioRxiv - Biophysics 2020Quote: ... Fusion Protein were purchased from Promega. Nickel superflow resin was purchased from Qiagen (Hilden ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested with trypsin (Promega) in 50 mM ABC overnight at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested with trypsin (Promega) at 37°C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were digested with trypsin (Promega) to be peptides and then processed according to the manufacturer’s protocol for TMT kit ...
-
bioRxiv - Plant Biology 2023Quote: ... and HiBiT Control Protein (N3010, Promega). We were unable to obtain soluble protein of AtARF9 ...
-
bioRxiv - Zoology 2023Quote: ... Proteins were digested with trypsin (Promega Porcine trypsin ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested by trypsin (Promega) over night at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: Purified NanoLuc protein (Promega REF G9711) was diluted to 10 µM in 0.1 mg/ml BSA solution ...
-
bioRxiv - Plant Biology 2021Quote: ... The ANAC50 protein was purified with the HaloTag® Protein Purification System (Promega, Madison, Wisconsin, United States) using 20 μL Expression reaction for each EMSA reaction. ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1500 μg total protein lysate was 100ul slurry of pre-cleared with Protein G agarose beads (Promega), followed by overnight incubation with AXL antibody (2ug Ab/ 100 ul lysate) ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant proteins were purified with MagneGST™ Protein Purification System (www.promega.com/protocols/; Promega, Madison, WI, USA).
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant GST-OsNAC5 fusion protein was subsequently purified with the MagneGST™ Protein Purification System (Promega), following the provided protocol.