Labshake search
Citations for Promega :
451 - 500 of 1165 citations for RT qPCR Master Mixes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The expression of reporter and reference genes were analyzed by quantitative PCR using GoTaq-qPCR Master Mix (Promega, #A6002), with the real-time PCR system (Light Cycler 480 ...
-
bioRxiv - Physiology 2019Quote: The expression profile of PKC isoforms in UMR106 cells was studied by RT-PCR using the GoTaq Green Master Mix (Promega) and the primers listed in Table 1 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Microbiology 2022Quote: ... then diluted 1:5 with nuclease-free water before 2 µL was used as template in a 10 µL GoTaq 1-Step RT-qPCR (Promega, A6020) reaction (69) ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse transcription of viral RNA followed by quantitative PCR was performed with GoTaq® Probe 1-Step RT-qPCR System (Promega) on a 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Amplification reactions were run in a 20 μL volume using the GoTaq 1-Step RT-qPCR System (Promega, Madison WI, USA) and the recommended manufacturer’s instructions as described in Cervera et al ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Developmental Biology 2020Quote: ... RT-qPCR was performed on an Applied Biosystems StepOne Plus Real-Time PCR system using GoTaq qPCR Master Mix with SYBR Green (Promega) and the primers listed in Supplemental Table 3 ...
-
bioRxiv - Molecular Biology 2021Quote: One-sixth of the SNS preparation (from above) was used for qPCR assays which were performed with the Promega GoTaq master mix (Promega). Each qPCR reaction was carried out in triplicate and in all cases two independent biological replicates per condition were assayed per run ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting cDNA was subjected to PCR or qPCR analysis using Phire Green Hot Start II PCR Master Mix (Promega) or GoTaq qPCR Master Mix (Promega) ...
-
bioRxiv - Physiology 2019Quote: Relative expression levels of Fgf23 were determined by qRT-PCR using 2 μl synthesized cDNA and the GoTaq qPCR Master Mix (Promega) on a Rotor-Gene Q (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR assays were performed using 1 ng of cDNA as template and the reactions were conducted using the GoTaq qPCR Master Mix (Promega). Real-time RT-PCR was performed on a MasterCycler Ep-Realplex thermal cycler (Eppendorf ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Developmental Biology 2022Quote: ... in a 12 µl mixture consisting of 6 µl Blue SYBR Green mix (Biozym) or GOTaq qPCR Master Mix (Promega), 2 µl primer pairs (2.5 µM each ...
-
bioRxiv - Microbiology 2022Quote: ... Amplification was performed in 20 μl reaction volumes with 40 ng template cDNA using GoTaq® qPCR master mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized by using qScript cDNA Synthesis Kit (QuantaBio, Beverly, MA) and PCR was performed with GoTaq qPCR Master Mix (Promega) with HPRT as the control gene ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative reverse transcription PCR (qRT-PCR) was performed according to the method of Ehira and Miyazaki43 using Go Taq qPCR Master Mix (Promega). Primers used for PCR and qRT-PCR are listed in Supplementary Table 5.
-
bioRxiv - Plant Biology 2022Quote: ... One microliter of cDNA (corresponding to 50 ng of total RNA) was amplified in 20 μL of reaction mix containing 1× Go Taq qPCR Master Mix (Promega) and 0.5 μM of each primer described in Supplemental Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... were used in qRT-PCR reactions to determine the relative mRNA levels of Tc_wap genes using GoTaq® qPCR Master Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... China and listed in Table S2) were incubated with 201tμL of the real-time PCR reaction mixture including GoTaq qPCR Master Mix (Promega, USA) at 95°C for 3 min ...
-
bioRxiv - Microbiology 2023Quote: ... Input gDNA or cDNA was added to the qPCR master mix containing 1X Colorless GoTaq® Flexi Buffer (Promega, USA), 4 mM magnesium chloride (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... core and modified histones and transcription factors at the HIV-1 LTR was assessed by quantitative PCR using primers spanning the full promoter (Table 1) with GoTaq qPCR Master mix kit (Promega) in a CFX Connect Real-Time PCR thermocycler (BioRad) ...
-
bioRxiv - Developmental Biology 2024Quote: ... cDNA was synthesized using Superscript III Reverse Transciptase (#18080044, ThermoFisher Scientific. qPCR assays were performed on the cDNA using Gotaq Green Master Mix (Promega) following the manufacturer’s instruction and read using CFX96 connect (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: ... using oligo (dT) as a primer and quantitative PCR analysis was performed using the GoTaq qPCR SYBR master mix (Promega) on a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... for gram-negative bacteria and cDNA library preparation was performed using the GoTaq® 2-Step RT-qPCR System (A6010, Promega, USA). The RT-PCR was done using the Applied Biosystems™ 7500 Real-Time PCR System and primers shown in the supplementary data table S2 (35-38) ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-qPCR was performed to determine the mRNA levels of CD24 and EMT biomarkers (Table S3) using GoTaq® qPCR Master Mix with SYBR green (Promega). The qPCR was performed in a total volume of 20µL per-reaction containing ...
-
bioRxiv - Microbiology 2020Quote: ... the fluorescence derived from the incorporation of BRYT Green® Dye into the double-stranded PCR products was measured at the end of each cycle using the GoTaq® qPCR Master Mix 2X Kit (Promega). The results were analysed using Bio-Rad CFX Maestro software ...
-
bioRxiv - Biochemistry 2021Quote: ... forward and reverse primer for the individual genes of interest (Eurofins Genomics, Germany) and GoTaq qPCR 2x Master Mix (Promega, Germany). The qPCR was carried out on a RotorGene Q (Qiagen ...
-
bioRxiv - Systems Biology 2020Quote: ... and 1.2 μl of the diluted cDNA was added as template to a final volume of 25 μl including 1x GoTaq qPCR Master Mix according to the manufacturer’s instructions (Promega, Mannheim, Germany). qRT-PCR was performed using the ViiA7 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Microbiology 2021Quote: ... and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega). DNA from non-transduced cell was isolated and amplified at the same time to demonstrate the absence of contamination ...
-
bioRxiv - Genomics 2021Quote: ... the resulting cDNA was diluted ten-fold and used as a template in a PCR reaction with GoTaq qPCR Master mix (Promega, USA) and run on a CFX384 Touch instrument (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Immunology 2024Quote: ... A total of 10 ng of cDNA was used for quantitative PCR in a total volume of 10 µl with GoTaq® qPCR Master Mix (Promega) and specific primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the expression of the CRISPRi targeted lncRNA genes was assessed through Real-Time PCR with the GoTaq® qPCR Master Mix (Promega). Primers sequences are listed in Supplementary Table 1.
-
bioRxiv - Genetics 2022Quote: ... Transfection efficiency was determined in parallel by preparing transfection mixes containing 4 μl FuGENE HD transfection reagent (Promega), 96 μl Opti-MEM (Life Technologies) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and used for qPCR (GoTaq qPCR Mix, Promega) using standard protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µl of the RT product (diluted 1:5) was used for semi-quantitative PCR or qPCR reactions with Promega PCR Mix (Promega, Madison, Wisconsin, USA) and SYBR Green PCR Mix (Applied Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... PCR products amplified by gene-specific RT-qPCR primers listed in Supplemental Table S1 were cloned in pGEM-T Easy vector (Promega, Madison, Wisconsin, USA) prior to their sequencing ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 μL of N2 primers and probe (2019-nCov CDC EUA Kit, Integrated DNA Technologies) and 10 μl of GoTaq 1-Step RT-qPCR (Promega, Madison, WI, USA). Thermal cycling was performed at 50°C for 15min for reverse transcription ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl of cDNA per sample were used and qRT-PCR was performed using the GoTaq® qPCR Master Mix (Promega, A6001) on a LightCycler 96 (Roche) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real Time PCR was done with unique oligonucleotide primers targeting ABCB11 gene using GoTaq® qPCR Master Mix (Promega Cat. No. A6001) following ‘manufacturer’s instructions on a Veriti Thermo Cycler from Applied Biosystems Waltham ...
-
bioRxiv - Microbiology 2021Quote: ... The qPCR for 16S rRNA was carried out with a reaction mixture containing 10.5 µL GoTaq® qPCR Master Mix (2X) (Promega, Madison, USA), 0.2 µM of each primer ...
-
bioRxiv - Immunology 2023Quote: ... 4 µl of cDNA per sample were used and qRT-PCR was performed using the GoTaq® qPCR Master Mix (Promega, #A6001) on a LightCycler 96 (Roche) ...
-
bioRxiv - Genetics 2024Quote: ... The qRT-PCR reactions were conducted in a 10 μL volume using the GoTaq qPCR Master Mix chemistry (Promega, Madison, Wisconsin, USA) and a CFX384 Touch Real-Time PCR Detection System (BioRad ...
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR reactions were performed using GoTaq qPCR system (Promega).
-
bioRxiv - Genomics 2022Quote: ... Transfection efficiencies were determined in parallel by preparing transfection mixes containing 4μL FuGENE HD transfection reagent (Promega, Cat#: E2311), 96μL Opti-MEM (Life Technologies ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription (RT) involved the Access RT-PCR System (Promega), as per the manufacturer’s instructions ...