Labshake search
Citations for Promega :
101 - 150 of 1658 citations for PCR Tube since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative Realtime PCR (qRT-PCR) was performed using GoTaq® 1-Step RT-qPCR kit (Promega) with primers specific for PEX1 (RE7039-RE7040 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the Wizard® SV Gel and PCR Clean-Up system (Promega) and then sequenced by Sanger sequencing at GENEWIZ (South Plainfield ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR master mix (Promega, USA) was used as per the manufacturer instructions to amplify the 16s rRNA marker gene ...
-
bioRxiv - Microbiology 2022Quote: ... PCR product was column purified (Promega) for subsequent in vitro transcription of nsp4 RNA using mMESSAGE mMACHINE T7 Transcription Kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Standard PCR conditions for GoTaq (Promega) were used as follows ...
-
bioRxiv - Plant Biology 2019Quote: ... GoTaq PCR Mastermix (Promega, Mannheim, Germany) was used to monitor cDNA amplification ...
-
bioRxiv - Developmental Biology 2020Quote: ... 64 µM PCR Nucleotide Mix (Promega), 1.5 mM MgCl2 and 0.2 µM of upstream and downstream primer each ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was column purified (Promega) for subsequent in vitro transcription of N RNA using mMESSAGE mMACHINE T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... PCRs were performed using GoTaq (Promega) on a Veriti thermal cycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was performed with GoTaq (Promega) and with primers listed in Table S9.
-
bioRxiv - Evolutionary Biology 2022Quote: ... or Wizard PCR purification kit (Promega), and then directly sequenced using the same and internal primers on an ABI 3130xl sequencer.
-
bioRxiv - Microbiology 2023Quote: ... [26]) and PCR chemicals by PROMEGA© with the following PCR conditions ...
-
bioRxiv - Microbiology 2023Quote: One step RT-PCR kit (Promega) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR nucleotide mix (Promega, U144B). Quantitative PCRs were performed in triplicate using primers against BNIP3 (Pair 1 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... TaqMan universal PCR master mix (Promega) and the CFX96 Touch Real-Time PCR Detection System (BioRad Laboratories ...
-
bioRxiv - Cell Biology 2023Quote: ... and PCR nucleotide mix (Promega, #U144B) were used to synthesise cDNA from 1 mg of RNA ...
-
bioRxiv - Microbiology 2023Quote: ... 0.2 mM PCR Nucleotide Mix (Promega) 10 μM of each primer ...
-
bioRxiv - Cell Biology 2022Quote: ... The columns were transferred to new tubes and incubated with 10 ng/μL sequencing-grade trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The columns were transferred to new tubes and incubated with 10 ng/μl sequencing-grade trypsin (Promega) (49) ...
-
bioRxiv - Genomics 2023Quote: ... The aqueous layer was carefully removed to a new tube and 10% weight/volume PEG8000 (Promega #V3011) was added and incubated on ice for 1 hour before centrifugation at 20,000 x g for 15 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Microbiology 2020Quote: ... The dcas9 PCR amplicon was purified using a Wizard SV Gel and PCR Clean-up kit (Promega) and digested with AscI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was then purified using the Wizard® SV Gel and PCR Clean-up System (Promega) and quantified using NanoDrop™ technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-up System (A9281, Promega) and the purified templates were used to produce single stranded digoxigenin (DIG)-labelled RNA probes with the T7 (P2075 ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 725bp segment of the Svep1 transcript (NM_153366.4; 746-11179) was PCR amplified (PCR Master Mix, Promega) with one pair of exon-exon boundary overlapping primers (5’ TGTGGTCCTCCAAGTCACGTA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... The PCR fragment was cleaned up using the Wizard SV Gel and PCR Clean-up System (Promega). The fragment was digested with EcoRI-HF and HindIII-HF (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Primers and remnants of the PCR reaction were removed using the Wizard PCR cleanup kit (Promega, USA). The concentration of the purified DNA was determined using an ND-2000 NanoDrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was run on the agarose gel and purified using PCR purification kit (A1222, Promega). The Alu PCR product was cloned into using pGEM-T Easy Vector (A1380 ...
-
bioRxiv - Molecular Biology 2019Quote: ... we purified PCR amplicons using the Wizard® SV Gel and PCR Clean-Up System (Promega, USA) and sequenced purified PCR products with BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems® ...
-
bioRxiv - Immunology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using the Wizard PCR Cleanup and Gel Purification system (Promega, Fitchburg, WI, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplicons were purified using the Wizard® SV Gel and PCR Clean-Up System kits (Promega), followed by Sanger sequencing (Eurofins) ...
-
bioRxiv - Plant Biology 2024Quote: ... The second PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega) and the Agencourt AMPure XP Kit (Beckman Coulter) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products (1.5Kb) of 16S rRNA gene were cleaned with Gel and PCR Clean-Up system (Promega, USA), and quantified by NenoDrop ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit for Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were pooled and purified with Wizard Gel and PCR Clean-up Kit (Promega, Madison, Wisconsin, USA). Purified PCR products were sequenced at Michigan State University ...
-
bioRxiv - Microbiology 2022Quote: ... After purification of the PCR product with Wizard® SV Gel and PCR Clean-Up System (Promega, UK), the arsM amplicon was sequenced at Microsynth (Balgach ...
-
bioRxiv - Microbiology 2021Quote: ... Positive constructs were identified by colony PCR using the segment-specific PCR primers and Taq green mastermix (Promega) with the following cycle profile ...
-
bioRxiv - Cancer Biology 2022Quote: ... Wizard® SV Gel and the PCR Clean-up System were used to clean the PCR products (Promega). Next ...
-
bioRxiv - Genetics 2019Quote: ... The PCR product was purified using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) according to manufacturer instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cleaned using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI), and samples were submitted to the Roy J ...
-
bioRxiv - Cancer Biology 2023Quote: ... All PCR reactions were run using 2 µL of extracted DNA in GoTaq® PCR Master Mix (Promega) and the following cycling protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR fragment was subsequently purified using the Wizard SV Gel and PCR Clean-Up System (A9281 - Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The PCR DNAs were gel purified (Promega Wizard SV Gel and PCR Clean-up System #A9282 ...
-
bioRxiv - Genomics 2020Quote: ... or PCR master mix (Promega, Wisconsin, USA). For ExTaq polymerase reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using GoTaq Green (Promega) according to the vendor protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using GoTaq Green (Promega) according to the vendor protocol ...
-
bioRxiv - Microbiology 2022Quote: PCR clean-up system (Promega, catalog #: A9285).