Labshake search
Citations for Promega :
201 - 250 of 3027 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... and lysed with lysis buffer (Promega). Suspensions were loaded into a white opaque 96-well plate ...
-
bioRxiv - Bioengineering 2023Quote: ... lysed in passive lysis buffer (Promega) and luciferase assays were performed using the Nano-Glo® Dual Reporter Assay Kit (Promega ...
-
bioRxiv - Immunology 2024Quote: ... then lysed with Lysis Buffer (Promega) for 15 min on mechanical horizontal rotator ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µl RT buffer 5x (Promega), 2.5 μl dNTPs 2.5 mM ...
-
bioRxiv - Bioengineering 2020Quote: ... Homozygous lpat2-3 T-DNA insertional mutants were identified by PCR using Promega PCR Master Mix (Promega) and combinations of the gene specific and T-DNA left border primers pairs ...
-
bioRxiv - Microbiology 2020Quote: ... The dcas9 PCR amplicon was purified using a Wizard SV Gel and PCR Clean-up kit (Promega) and digested with AscI and HindIII ...
-
bioRxiv - Microbiology 2020Quote: ... PCR product was then purified using the Wizard® SV Gel and PCR Clean-up System (Promega) and quantified using NanoDrop™ technology ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: ... The PCR products were purified using the Wizard SV Gel and PCR Clean-up System (A9281, Promega) and the purified templates were used to produce single stranded digoxigenin (DIG)-labelled RNA probes with the T7 (P2075 ...
-
bioRxiv - Developmental Biology 2021Quote: ... a 725bp segment of the Svep1 transcript (NM_153366.4; 746-11179) was PCR amplified (PCR Master Mix, Promega) with one pair of exon-exon boundary overlapping primers (5’ TGTGGTCCTCCAAGTCACGTA 3’ ...
-
bioRxiv - Immunology 2020Quote: ... The PCR fragment was cleaned up using the Wizard SV Gel and PCR Clean-up System (Promega). The fragment was digested with EcoRI-HF and HindIII-HF (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Primers and remnants of the PCR reaction were removed using the Wizard PCR cleanup kit (Promega, USA). The concentration of the purified DNA was determined using an ND-2000 NanoDrop spectrophotometer ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was run on the agarose gel and purified using PCR purification kit (A1222, Promega). The Alu PCR product was cloned into using pGEM-T Easy Vector (A1380 ...
-
bioRxiv - Molecular Biology 2019Quote: ... we purified PCR amplicons using the Wizard® SV Gel and PCR Clean-Up System (Promega, USA) and sequenced purified PCR products with BigDye® Terminator v3.1 cycle sequencing kit (Applied Biosystems® ...
-
bioRxiv - Immunology 2021Quote: ... containing Proteinase K and target regions were amplified by PCR using the GoTaq G2 PCR mastermix (Promega). Correct and unique amplification of the target regions was verified by agarose gel electrophoresis before purifying PCR products using the QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were purified using the Wizard PCR Cleanup and Gel Purification system (Promega, Fitchburg, WI, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplicons were purified using the Wizard® SV Gel and PCR Clean-Up System kits (Promega), followed by Sanger sequencing (Eurofins) ...
-
bioRxiv - Plant Biology 2024Quote: ... The second PCR products were purified using the Wizard SV Gel and PCR Clean-up System (Promega) and the Agencourt AMPure XP Kit (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell lysis was performed using 50ul of cold lysis buffer (resuspension buffer, 0.1% NP-40, 0.1% Tween-20, and 0.01% Digitonin (Promega)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 cells were washed with 1X PBS buffer and then lysed with 1X passive lysis buffer (Promega). The cells were cleared of any cell debris by centrifugation at 14000 rpm for 10 min at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products (1.5Kb) of 16S rRNA gene were cleaned with Gel and PCR Clean-Up system (Promega, USA), and quantified by NenoDrop ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR products were purified using a Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) kit for Sanger sequencing.
-
bioRxiv - Microbiology 2020Quote: ... PCR products were pooled and purified with Wizard Gel and PCR Clean-up Kit (Promega, Madison, Wisconsin, USA). Purified PCR products were sequenced at Michigan State University ...
-
bioRxiv - Microbiology 2022Quote: ... After purification of the PCR product with Wizard® SV Gel and PCR Clean-Up System (Promega, UK), the arsM amplicon was sequenced at Microsynth (Balgach ...
-
bioRxiv - Microbiology 2021Quote: ... Positive constructs were identified by colony PCR using the segment-specific PCR primers and Taq green mastermix (Promega) with the following cycle profile ...
-
bioRxiv - Cancer Biology 2022Quote: ... Wizard® SV Gel and the PCR Clean-up System were used to clean the PCR products (Promega). Next ...
-
bioRxiv - Genetics 2019Quote: ... The PCR product was purified using Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) according to manufacturer instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The PCR product was cleaned using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI), and samples were submitted to the Roy J ...
-
bioRxiv - Cancer Biology 2023Quote: ... All PCR reactions were run using 2 µL of extracted DNA in GoTaq® PCR Master Mix (Promega) and the following cycling protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... The PCR fragment was subsequently purified using the Wizard SV Gel and PCR Clean-Up System (A9281 - Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cells were washed once with 1X PBS and lysed in 1X PLB (Passive Lysis Buffer) buffer (Promega). Afterwards ...
-
bioRxiv - Neuroscience 2019Quote: ... The PCR DNAs were gel purified (Promega Wizard SV Gel and PCR Clean-up System #A9282 ...
-
bioRxiv - Genomics 2020Quote: ... or PCR master mix (Promega, Wisconsin, USA). For ExTaq polymerase reactions ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using GoTaq Green (Promega) according to the vendor protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... PCR was performed using GoTaq Green (Promega) according to the vendor protocol ...
-
bioRxiv - Microbiology 2022Quote: PCR clean-up system (Promega, catalog #: A9285).
-
bioRxiv - Microbiology 2019Quote: ... PCR products were digested with DpnI (Promega) to remove template plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... Transformants were screened using GoTaq PCR (Promega) with universal M13F (−20 ...
-
bioRxiv - Biophysics 2021Quote: ... using the Access RT-PCR System (Promega), and then exchanged with exon 6b in mH1 using the Quikchange method of site-directed mutagenesis (SDM ...
-
bioRxiv - Microbiology 2022Quote: Colony PCR using GoTaq DNA polymerase (Promega) was performed on isolates not identified by MALDI-TOF MS ...
-
bioRxiv - Molecular Biology 2023Quote: ... a PCR using GoTaq G2 polymerase (Promega) was performed to specifically amplify the wild-type target locus ...
-
bioRxiv - Neuroscience 2023Quote: ... then PCR amplified with GoTaq MasterMix (Promega) and subsequently digested with a restriction enzyme to distinguish wild type and mutant alleles (Table 1) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCRs were performed with GoTaq Flexi (Promega) for 30 cycles of ...
-
bioRxiv - Microbiology 2023Quote: PCR products and a standard ladder (Promega) were electrophoresed on 1% agarose gels in 1X TBE for 1 hr at 85V ...
-
bioRxiv - Microbiology 2024Quote: ... 6μL Promega PCR amplification-grade water (Promega) and 2 μL of the sample DNA (corresponding to about 20 ng) ...
-
bioRxiv - Microbiology 2020Quote: ... 2.5 μl 10× Taq polymerase buffer (Promega), 0.5 U Taq DNA polymerase (Promega ...
-
bioRxiv - Bioengineering 2022Quote: ... adding 75 μl Luciferase assay buffer (Promega Dual-Luciferase Reporter Assay System ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5X Green GoTaq® Reaction Buffer (Promega), 25mM MgCl2 ...
-
bioRxiv - Microbiology 2019Quote: ... 75 μL RNA Lysis Buffer (Promega kit), followed by 350 μL RNA Dilution Buffer (Promega kit ...