Labshake search
Citations for Promega :
701 - 750 of 4075 citations for NGS ChIP Seq kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Amplification was performed in 20 μl reaction volumes with 40 ng template cDNA using GoTaq® qPCR master mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... One microliter of cDNA (corresponding to 50 ng of total RNA) was amplified in 20 μL of reaction mix containing 1× Go Taq qPCR Master Mix (Promega) and 0.5 μM of each primer described in Supplemental Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins bound to magnetic beads were washed twice with 100 μL of 25 mM NH4HCO3 and on-beads digested with 200 ng of trypsine/LysC (Promega) for 1 hour in 100 μL of 25 mM NH4HCO3 at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... Digestion of proteins in the gel pieces was done by covering them with a trypsin solution containing (8 ng/µL sequencing-grade trypsin (Promega), dissolved in 50 mM NH4HCO3with 10% ACN) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the Immunoprecipitated samples were in-solution digested overnight at 37 °C in 400 ng of mass spectrometry grade trypsin (Promega) enzyme ...
-
bioRxiv - Molecular Biology 2022Quote: ... Total RNA was extracted from 400 μL of each fraction (spiked with 0.2 ng exogenous control FFLuc mRNA; Promega # L4561) by adding 600 μL TRIzol (Thermo Fisher # 15596018 ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Immunology 2023Quote: ... pI.18-3xFlag-myRIG-I or pI.18-3xFlag-roRIG-I (25 ng/well each) together with transfection control pLR-SV40-Renilla (Promega) (50 ng/well ...
-
bioRxiv - Biochemistry 2023Quote: ... Total RNA was extracted from 400 μL of each fraction (spiked with 0.2 ng exogenous control FFLuc mRNA; Promega # L4561) by adding 600 μL TRIzol (Thermo Fisher # 15596018 ...
-
bioRxiv - Biochemistry 2023Quote: ... The gel pieces were dehydrated using 100% ACN before 25 µl of 12 ng/µl sequence grade modified trypsin porcine (Promega) in 25 mM ABC was added ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... 100 ng of either XeARPP19 or ClyARPP19 were incubated with 200 μM ATP and 25 units of recombinant bovine PKA (Promega) in PKA Buffer for 3 hours at 37°C under 1200 RPM stirring ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 500 ng of each of the packaging plasmids were transfected into 293T cells using FuGENE 6 transfection reagent (Promega). The viral media was exchanged after 24 h ...
-
bioRxiv - Biochemistry 2023Quote: ... then alkylated (100 mM iodoacetamide in 100 mM ammonium bicarbonate at room temperature for 45 minutes) prior to in-gel trypsin digestion (30 μL of 6 ng/μL recombinant sequencing-grade trypsin (Promega) in 100 mM ammonium bicarbonate per cubed band ...
-
bioRxiv - Molecular Biology 2023Quote: ... The library preparation involved using 100 ng of genomic DNA spiked with 1% (w/w) of unmethylated lambda DNA from Promega. Subsequently ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 50 ng of the plasmid encoding for the GFP-stop-Luc reporter were mixed with 1.1 μ FuGENE HD reagent (Promega), incubated for 10 min ...
-
bioRxiv - Plant Biology 2023Quote: ... cDNAs were obtained from 400 ng of RQ1-treated RNA using 1 μl of GoScript Reverse Transcriptase (Cat. No. A5003; Promega) in a 20-μl final volume reaction using random primers (Cat ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Plant Biology 2023Quote: ... Approximately 20 ng of trichome DNA was amplified by combining 0.25 μM primer and 1X GoTaq Green Master Mix (Promega, USA) in a 50μl reaction volume ...
-
bioRxiv - Molecular Biology 2023Quote: ... gel pieces were dried and subsequently rehydrated in solution containing 12 ng/μL Trypsin Gold (mass spectrometry grade from Promega), 0.01% ProteaseMAX surfactant (Promega ...
-
bioRxiv - Cell Biology 2022Quote: ... on-bead digestion was performed by addition of 100 μL trypsinization buffer (50 mM ammonium bicarbonate, Sigma and 300 ng trypsin per column, Trypsin-gold V5280 Promega) for 1 h at 23°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... The gel slices were then reduced and alkylated followed by destaining and in-gel digestion using 125 ng Trypsin/LysC (V5072, Promega) as previously described (Shevchenko ...
-
bioRxiv - Cell Biology 2023Quote: ... gel pieces were reswelled in 60 mL of 50 mM NH4HCO3 buffer containing 10 ng/mL of trypsin (modified porcine trypsin sequence grade, Promega) incubated for one hour at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
bioRxiv - Genomics 2022Quote: ... Each transfection reaction consists of 20 μg of testing vector and 500 ng of Renilla-expressing phRL-TK (Promega #6251) mixed with 3.5E6 cells in buffer T using 100 μL Neon Tips (Invitrogen #MPK10025 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... we transfected 500,000 ANBL6 cells with 1 ug of reporter plasmid plus 250 ng of Rinella plasmids pRL-SV40 and pGL3 control (Promega) in biological triplicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... The isolated RNAs (20 ng) were reverse-transcribed and quantitative PCR (qPCR) were perform using GoTaq Probe 1-Step RT-PCR system (Promega) in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Cells were transfected the following day with 1,000 ng of either the control plasmid or the BFP-miR-L plasmid using Fugene HD (Promega #E2311) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... the samples were diluted with seven volumes of 50 mM ammonium bicarbonate and incubated for 16 h at 37 °C with 400 ng of trypsin (ratio 1:50; “Trypsin Gold”, Promega).
-
bioRxiv - Synthetic Biology 2024Quote: ... Cells were transfected the following day with 1,000 ng of either the control plasmid or the BFP-miRNA plasmid using Fugene HD (Promega #E2311) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK293 cells were then plated onto 35 mm glass coverslips pre-coated with poly-D-lysine (100 g/mL) and transfected with 300 ng of each plasmid using FuGene transfection reagent (Promega) or Lipofectamine 2000 (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... A nested PCR for the detection of the FRT-scar present in RDV-50.stop MHV68 was performed using 200 ng of genomic DNA with GoTaq polymerase (Promega) using primers (dPCR_R1_for GGACCACGCTTTCCAGAGAA ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were transfected with pCI-neo-hsSART1 full-length and ideletion mutants with 1 ng/μl using ViaFect Transfection Reagent (Promega). After 4 h incubation ...
-
bioRxiv - Systems Biology 2023Quote: ... The panel of ssDNA-labelled antibodies (250 ng/ml for each antibody) was mixed with 2 U/µl RNAsin Plus (Promega) and 0.1% Triton X-100 in PBS:PFBB (1:1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-30 ng of the original RNA was used to perform qPCR for Dkk3 and Dkk1 using GoTaq qPCR Master Mix (Promega) in a CFX96 Bio-rad system following the manufacturer’s protocol (2 min at 95°C followed by 40 cycles of denaturing at 95°C and annealing/extension at 60°C) ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega, cat# A6110). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... in-gel digestion was performed on the PNS and enriched peroxisomal membranes using 300 ng trypsin (sequencing grade modified trypsin V5111; Promega) after reduction with 10 mmol/L dithiothreitol and alkylation with 55 mmol/L iodoacetamide proteins as described previously (Wolters et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 500 ng of RNA were reverse-transcribed using M-MLV Reverse Transcriptase and Random Hexamer primers (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 49 ng of a TP1-Luciferase (Kurooka et al., 1998; Minoguchi et al., 1997) and 1 ng Renilla-Luciferase (pRL-TK, Promega) using Lipofectamine™ 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Integrated sgRNAs in each lymphoma sample were amplified from 100 ng of genomic DNA using GoTaq Green Master Mix (Promega) and indexing primers with unique overhangs (12) ...
-
bioRxiv - Cell Biology 2023Quote: ... dilute with 4 volumes of 20 mM Tris-HCl pH8 / 2 mM CaCl2 before overnight digestion at room temperature with 100 ng sequencing grade trypsin (Promega). Samples were centrifuged ...
-
bioRxiv - Genetics 2024Quote: ... Cells were co-transfected after 24 hours with 50 ng of the CNTNAP5 luciferase reporter constructs along with 10 ng of pRL-TK Renilla luciferase internal control using FuGENE HD transfection reagent (Promega). At 48 hours post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... The protein pellets were resuspended in 50 μl 100 mM TEAB and digested with 200 ng trypsin (Promega sequencing grade) overnight at 37°C.
-
bioRxiv - Microbiology 2024Quote: ... Flp-In T-REX HeLa cells were transfected with 1.8 μg of pOGG4 plasmid and 200 ng of pcDNA5/FRT/TO plasmid encoding the relevant transgene cassette using FuGENE HD transfection reagent (Promega). Cells with a stably integrated transgene were selected with 150 μg/mL hygromycin for 4-5 days ...
-
“Identification of microRNAs regulated by E2F transcription factors in human pluripotent stem cells”bioRxiv - Developmental Biology 2024Quote: ... 500 ng of total RNA was used for cDNA synthesis with 15 mM of random hexamers and MMLV reverse transcriptase (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... gel regions were diced and proteins were subjected to in-gel digestion with 6 ng/μL trypsin (Promega, Madison, WI, USA) in 50 mM ammonium bicarbonate at 37 °C for 10-12 hours ...