Labshake search
Citations for Promega :
401 - 450 of 6841 citations for Human Serine threonine protein kinase PAK 1 PAK1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Microbiology 2019Quote: ... SDC concentration was adjusted to 1% and 120 µg of proteins from each bacterial culture were digested by addition of trypsin (Promega) in a 1:50 (enzyme:protein ...
-
bioRxiv - Microbiology 2019Quote: Protein digestion - for samples processed with reagent 1 and 2 as well as for supernatants (proteomes) MS grade trypsin (Promega) was used at 1:1000 w/w protease:protein ...
-
bioRxiv - Bioengineering 2020Quote: ... In-solution protein digestion was carried out in a ratio of 1:25 w/w Trypsin/Lys-C (Mass Spectrometry Grade, Promega) to protein overnight at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns with cellular extracts were carried out as described for GFP-immunoprecipitations using 1-2 μg of GST-fused proteins bound to glutathione magnetic beads (Promega). For immunoprecipitations of recombinant proteins ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Cell Biology 2022Quote: ... The trapped proteins were washed four times with the methanol TEAB buffer and then digested using 1 µg Trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... The sample was diluted 1:7 with 0.1 M NH4HCO3 before overnight digestion of proteins with trypsin (Promega, cat#V5113) at 30°C ...
-
bioRxiv - Cell Biology 2021Quote: ... v/v) and dehydration in ACN, proteins were digested overnight at 37 °C with trypsin (1:50, w/w) (V5280, Promega). Peptides were extracted from the gel in 50% ACN/0.1% formic acid ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were digested either with trypsin in a trypsin/protein ratio of 1/50 (w/w) (Promega Cat. No. V5111) and incubated overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were diluted 8x in 50 mM ammonium bicarbonate to reduce the urea concentration to 1 M and protein digestion was performed overnight at 37 C by addition of 2 µg of trypsin (Promega) per sample.
-
bioRxiv - Plant Biology 2022Quote: ... were reduced with DTT and then alkylated with iodoacetamide and digested overnight using Lys-C/Trypsin (1:50, enzyme to protein; Promega). After terminating the digestion with 1% trifluoroacetic acid ...
-
bioRxiv - Microbiology 2023Quote: ... the samples were digested by trypsin with 1/80 (w/w) trypsin/total protein ratio (Sequencing Grade Modified Trypsin, Promega) according to the manufacturer recommendations ...
-
bioRxiv - Cell Biology 2023Quote: ... packed column (now loaded with the protein sample) 20 µL of Trypsin digestion solution (1 µg MS-grade Trypsin (Promega) in 50 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2022Quote: Halo-3F-SOCS1 expression was induced with doxycycline overnight (1 μg/mL) and Halo-tagged protein detected by incubation with fluorescent Halo TMR ligand (10 nM; Promega) overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Strap binding buffer was applied to precipitate proteins on quartz and proteolysis took place during 14 hrs at 37°C with 1 µg Trypsin sequencing grade (Promega). After speed-vacuum drying of eluted peptides ...
-
bioRxiv - Biochemistry 2023Quote: ... N- glycan release was achieved after digestion with PNGase F (1 U/10 µg protein at 37 °C overnight; Promega). Released N-glycans were hydrolysed with 25 µl of 100 mM ammonium acetate at pH 5 (1 h at RT) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Alkylated proteins were then cleaved using a two-step digestion: first with Endoproteinase Lys-C (ratio 1:33 enzyme: lysate, Promega) for 1 hour at 37 °C then with Trypsin (ratio 1:33 enzyme ...
-
bioRxiv - Biochemistry 2024Quote: ... at a 1:75 enzyme to protein ratio for 6 h at 30 °C and then by trypsin (V5111, Promega) (1:50 enzyme to protein ratio ...
-
bioRxiv - Cancer Biology 2024Quote: ... Denatured proteins were enzymatically digested for 14 h at 37 °C with 1 µg of sequencing-grade Trypsin (V511A, Promega). After speed-vaccum drying ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Cancer Biology 2021Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1X sample buffer (4X stock ...
-
bioRxiv - Cancer Biology 2022Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1 X sample buffer (4 X stock ...
-
bioRxiv - Cell Biology 2022Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1X sample buffer (4X stock ...
-
bioRxiv - Plant Biology 2023Quote: ... proteins were co-expressed using TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pooled human male DNA (G3041, Promega and 4312660, Life Technologies) were used to generate calibration curves and serve as reaction controls ...
-
bioRxiv - Biochemistry 2020Quote: SETD2-HaloTag® human ORF in pFN21A was procured from Promega. Deletion mutants of SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Biochemistry 2020Quote: SETD2-HaloTag® human ORF in pFN21A was procured from Promega. Deletion mutants of SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human 26S proteasome purified from HEK293 cells was purchased from Promega. The proteasome chaperoning reaction tests were carried out as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... Human normal genomic DNA was obtained from Promega (Madison, WI, USA) and the values are averages of three replicates ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 ng/ml recombinant human fibroblast growth factor (G5071, Promega).
-
bioRxiv - Cancer Biology 2020Quote: ... in a background of 130ng of normal human genomic DNA (Promega) was used as a positive control ...
-
bioRxiv - Cell Biology 2019Quote: ... and human samples were performed using GoTaq green master mix (Promega) and the following amplification conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 830bp or 800bp human STIM1 promoter into pGL3 basic vector (Promega) between XhoI and HindIII ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein G magnetic beads (Promega; G7471) were washed with PBS buffer and then added to the supernatant in a 1:10 volumetric ratio ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was digested by trypsin (Promega) at a ratio of 1:50 (trypsin:protein ...
-
bioRxiv - Biophysics 2020Quote: ... Fusion Protein were purchased from Promega. Nickel superflow resin was purchased from Qiagen (Hilden ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested with trypsin (Promega) in 50 mM ABC overnight at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested with trypsin (Promega) at 37°C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were digested with trypsin (Promega) to be peptides and then processed according to the manufacturer’s protocol for TMT kit ...
-
bioRxiv - Plant Biology 2023Quote: ... and HiBiT Control Protein (N3010, Promega). We were unable to obtain soluble protein of AtARF9 ...
-
bioRxiv - Zoology 2023Quote: ... Proteins were digested with trypsin (Promega Porcine trypsin ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested by trypsin (Promega) over night at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: Purified NanoLuc protein (Promega REF G9711) was diluted to 10 µM in 0.1 mg/ml BSA solution ...
-
bioRxiv - Plant Biology 2020Quote: ... Proteins were dissolved in 40 mM ammonium bicarbonate and digested by 1 ug sequence-grade modified trypsin (Promega, Madison, WI, USA) at 37 °C overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... Heterologous expression of proteins was achieved by transfecting cells with 1 □g of plasmid DNA/35 mm using FuGENE HD (Promega; E2311), as previously described (Webb et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were then alkylated using 15mM chloroacetamide at 37°C for 30min and further digested using sequencing-grade modified trypsin (1/25, w/w, trypsin/protein; Promega, USA) at 37°C overnight ...
-
bioRxiv - Biochemistry 2022Quote: Peptide mass spectrometry was completed after reduction with 10 mM DTT and alkylation with 55 mM iodoacetamide and protein digestion overnight at 37 °C at a 1:50 ratio of trypsin (Promega, UK). Tryptic peptides were analysed by nano-scale capillary LC-MS/MS with an Ultimate U3000 HPLC (ThermoFisher Scientific Dionex ...