Labshake search
Citations for Promega :
251 - 300 of 6841 citations for Human Serine threonine protein kinase PAK 1 PAK1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and proteins were in-gel digested with trypsin (Promega, Madison, WI, USA; ratio 1:100) at 37°C overnight after de-staining ...
-
bioRxiv - Molecular Biology 2021Quote: ... chymotrypsin in a chymotrypsin/protein ratio of 1/20 (w/w) (Promega Cat. No. V1061) and incubated overnight at 25 °C or endoproteinase GluC in a GluC/protein ratio of 1/20 (w/w ...
-
bioRxiv - Developmental Biology 2022Quote: ... The 50μg of proteins were then trypsin digested overnight at 37 °C (1:25; Promega) using the filter aided sample preparation (FASP ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were extracted by methanol-chloroform precipitation and digested with 1 μg of trypsin (Promega) in 100 mM EPPS (pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... followed by overnight digestion with trypsin (enzyme to protein ratio of 1:100) (Promega, Germany) at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Proteins were digested overnight at 37° C with 1 μg mass spectrometry grade Trypsin (Promega). The resulting peptide sample was acidified with 10% formic acid and 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein samples eluted with biotin were digested in-solution with 1 ug Trypsin/LysC (Promega) overnight at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein detection was done using primary antibody anti-HaloTag monoclonal antibody (1:1,000 dilution, Promega), primary antibody anti-MamE polyclonal antibody (1:3,000 dilution ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Trypsin digestion was carried out overnight at 37 °C with 1:50-1:100 enzyme– protein ratio of sequencing grade-modified trypsin (Promega V5111) in 50 mM NH4HCO3 pH 7.5 ...
-
bioRxiv - Genomics 2019Quote: ... 35S labeled proteins were synthesized in vitro using the TNT T7 Quick for PCR DNA kit (Promega, L5540). Labeled proteins were incubated with MBP-tagged proteins in TNEN50 (50mM Tris pH7.5 ...
-
bioRxiv - Microbiology 2021Quote: ATPase activity of the purified proteins was determined using two kits – Enliten ATPase assay (FF2000, Promega, Moscow, Russia) and malachite green phosphate assay (MAK307 ...
-
bioRxiv - Cell Biology 2019Quote: ... In vitro translated (IVT-) proteins were synthesized using a TNT quick-coupled transcription-translation kit (Promega, Madison, WI). For synthesizing the Pav and PavDEAD proteins ...
-
bioRxiv - Cell Biology 2023Quote: 35S-radiolabeled Tom40 precursor proteins were synthesized in vitro using the TNT Quick Coupled Transcription/Translation kit (Promega). Transcripts for MCO6 encoding 3 additional N-terminal methionine residues for radiolabelling of the Mco6 protein which lacks internal methionine residues ...
-
bioRxiv - Microbiology 2021Quote: ... The kinase activity assay was performed with 4 µl beads in a 384-well plate using the ADP-Glo™ Kinase Assay (Promega, Madison, WI). The luminescence of each well was read using a Synergy™ H1 Hybrid Multi-Mode Microplate Reader (BioTek Instruments ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Biochemistry 2022Quote: ... The proteins were digested with 1 μg lysyl endopeptidase (LysC) (FUJIFILM Wako Pure Chemical Corporation) and 1 μg trypsin (Promega, Tokyo, Japan) overnight at 37°C on a shaking incubator ...
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega, V5113) for 12 h at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Proteins were digested into peptides with 12μL of 1:10 Trypsin Gold (Promega, Madison, Wisconsin, V528A) in 50mM TEAB per sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested by incubation with sequencing-grade modified trypsin (1/50 w/w; Promega,V5113) for 12 h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... proteins were digested for 6 h at 37°C with 4ng.μL−1 of modified trypsin (Promega) dissolved in 50 mM NH4CO3 ...
-
bioRxiv - Neuroscience 2019Quote: ... Proteins were digested overnight at 37°C with 1 μg of mass spectrometry grade Trypsin (Promega). The resulting peptide samples were cleaned up for mass spectrometry in a Sep-Pak C18 column (Waters ...
-
bioRxiv - Biochemistry 2022Quote: ... The protein from lysed cells were digested in 1 µL 10ng/µL of trypsin/LysC (Promega) in 100mM TEAB (ProtiFi) ...
-
bioRxiv - Biophysics 2023Quote: ... the proteins were digested into tryptic peptides by incubation with 1□µg sequencing grade trypsin (Promega) overnight at 37□°C ...
-
bioRxiv - Neuroscience 2023Quote: ... After the sequential digestion with LysC and trypsin (Promega, each protease to protein ratio 1:80), beads were retained with a magnetic rack and samples were filtered with Costar Spin-X spin filters (0·22 µm cut-off ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µg of reconstituted protein was digested in 0.05 N HCl with 1 µg pepsin (Promega) without prior reduction/alkylation at a volume of 200 µl 50 °C for 3 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... The identity of each cell line was confirmed by DNA fingerprinting via short tandem repeats at the time of mRNA and total protein lysate preparation using the PowerPlex 1.2 kit (Promega).
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were then digested with LysC at 1ug/100ug protein (Promega) for 3 h at room temperature (RT ...
-
bioRxiv - Plant Biology 2020Quote: ... Fusion proteins were purified using MagnetHis™ protein purification system (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: ... Proteins were precipitated through the addition of Protein Precipitation Solution (Promega) followed by vigorous vortexing ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega, Madison WI) at 450 nm absorbance.
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...