Labshake search
Citations for Promega :
51 - 100 of 1320 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: Each 20 µl endpoint PCR reaction contained 10 µl of Gotaq Green Master Mix (2X) (Promega, Madison, WI), 1 µl (5 µM ...
-
bioRxiv - Pathology 2020Quote: ... GoTaq® Hot Start Master Mixes 2x (Promega), specific primers (5’ CGCATATGATGGAGCACGTGCA 3’ and 5’ CGGGATCCCTACAGTTTGGCG ...
-
bioRxiv - Microbiology 2022Quote: Each colony PCR consisted of a 25-μl reaction containing: 12.5 μl 2x GoTaq Green Master mix (Promega, UK), 0.5 μl of the reverse and forward primers (10 μM each) ...
-
bioRxiv - Plant Biology 2023Quote: ... Gene-specific and transposon multiplex primer PCR was performed under standard conditions with 2X GoTaq Green Master Mix (Promega) with 5% DMSO (v/v).
-
bioRxiv - Molecular Biology 2019Quote: ... qPCR amplifications (12 μl) were done in duplicates using 1 μl of cDNA and the GoTaq Probe 2X Master Mix (Promega) on a LightCycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2019Quote: ... subspecies nebraskensis were carried out in 20 μl reactions containing 10 μl of 2X GoTaq® Green Master Mix (Promega), 1 μl of each forward and reverse primer (5 μM) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR reaction was performed in 25 μL final volumes and consisted of 12.5 μL GoTaq® G2 Hot Start Colorless Master Mix (2X - Promega), 1 μL of each primer (10 μM) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR Tag analysis was performed either by adding 1.8 μL of yeast lysate used as template DNA to 6.25 μL of 2X GoTaq® Green Master Mix (Promega), 4.75 μL of nuclease-free water and 400 nM of each primer or by adding 1 µl of yeast lysate to 5 µl of DreamTaq Green PCR Master Mix (2X ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Developmental Biology 2021Quote: ... or Gotaq Master Mix (Promega) and then subjected to 2% agarose gel electrophoresis ...
-
bioRxiv - Plant Biology 2022Quote: ... 1X GoTaq Master Mix (Promega), and 500nM each of forward and reverse primers ...
-
bioRxiv - Genetics 2021Quote: ... GoTaq® Master Mix (PROMEGA) 1X and 0.2 µM of each primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... using GoTaq Master Mix (Promega) with the gene specific primers (Table 1).
-
bioRxiv - Microbiology 2022Quote: ... GoTaq Green Master Mix (Promega) was used to run PCR for 30 cycles using manufacturers suggested parameters 55 ...
-
bioRxiv - Immunology 2022Quote: GoTaq qPCR Master Mix (Promega) was used in a final reaction volume of 10μl containing 10 ng of template cDNA ...
-
bioRxiv - Genetics 2022Quote: ... 10 μl 2x GoTaq® Master Mixes (Promega, M7123), and 6 μl water ...
-
bioRxiv - Microbiology 2023Quote: ... 10 µL 2X master mixture (Promega, Madison, WI, USA), 1 µL forward and reverse primers (for each ...
-
bioRxiv - Microbiology 2019Quote: ... and 12.5 µl of 1x of Hot Master Mix (Promega GoTaq® Green Master Mix) to a final volume of 25 µl ...
-
bioRxiv - Microbiology 2020Quote: ... the fluorescence derived from the incorporation of BRYT Green® Dye into the double-stranded PCR products was measured at the end of each cycle using the GoTaq® qPCR Master Mix 2X Kit (Promega). The results were analysed using Bio-Rad CFX Maestro software ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR reactions were performed at 25µl total with 12.5 ul 2X Promega Hot Start Master Mix (Promega Corporation, Madison, USA) and the primer conditions listed in Tab 1 ...
-
bioRxiv - Biochemistry 2021Quote: ... forward and reverse primer for the individual genes of interest (Eurofins Genomics, Germany) and GoTaq qPCR 2x Master Mix (Promega, Germany). The qPCR was carried out on a RotorGene Q (Qiagen ...
-
bioRxiv - Plant Biology 2020Quote: ... Individual reactions conducted with UGA-CPES consisted of a 10 µL mixture containing 5 µL of GoTaq Green Master Mix 2X (Promega Corporation), 0.5 µL of template DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 20 μl reaction volume was prepared for each reaction using the GoTaq® Green Master 2X Mix (M7122, Promega, Belgium) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 25 ng of c-DNA was used per reaction in each well containing the 2X SYBR green PCR master mix (Promega, USA) along with appropriate primers ...
-
bioRxiv - Microbiology 2023Quote: Insertion sites in individual clones were mapped using a two-step nested arbitrary PCR approach using 2X GoTaq master mix (Promega M7122). The first reaction (1X GoTaq master mix ...
-
bioRxiv - Immunology 2023Quote: ... 25 ng of c-DNA was used per reaction in each well containing the 2X SYBR green PCR master mix (Promega, USA) along with appropriate primers ...
-
bioRxiv - Neuroscience 2021Quote: ... using GoTaq qPCR Master Mix (Promega). Primers used had an efficiency level between 85% and 110% ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR master mix (Promega, USA) was used as per the manufacturer instructions to amplify the 16s rRNA marker gene ...
-
bioRxiv - Cancer Biology 2020Quote: ... GoTaq® qPCR Master Mix (Promega) was used as a SYBR master mix reagent for the qPCR procedures ...
-
bioRxiv - Developmental Biology 2021Quote: ... or GoTaq qPCR Master Mix (Promega), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... using GoTaq qPCR Master Mix (Promega) following manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... using GOTaq qPCR Master Mix (Promega) or SYBR Green qPCR Master Mix (Life Technologies) ...
-
bioRxiv - Plant Biology 2021Quote: ... GoTaq® qPCR Master Mix (Promega) was used for quantitative real-time PCR ...
-
bioRxiv - Molecular Biology 2021Quote: ... using GoTaq qPCR Master Mix (Promega) (3 min at 95 °C ...
-
bioRxiv - Microbiology 2022Quote: ... using GoTaq Green Master Mix (Promega) with an initial denaturation of 5 min at 95°C ...
-
bioRxiv - Plant Biology 2022Quote: ... and GoTaq qPCR Master Mix (Promega). Relative transcript level was calculated using the comparative Δ Ct method and normalized to the PP2A gene transcript levels ...
-
bioRxiv - Molecular Biology 2022Quote: ... using GoTaq qPCR Master Mix (Promega).
-
bioRxiv - Cell Biology 2020Quote: ... and master mix (Promega, Madison, WI) were combined with corresponding primers for ovarian markers Amhr2 ...
-
bioRxiv - Microbiology 2019Quote: ... GoTaq Green Master Mix from Promega UK was used with 16S rDNA PCR primers in the initial run ...
-
bioRxiv - Molecular Biology 2020Quote: ... using GoTaq qPCR Master Mix (Promega). Cycling parameters were as follows ...
-
bioRxiv - Plant Biology 2020Quote: ... using GoTaq qPCR Master Mix (Promega), in a final volume of 10 μl ...
-
bioRxiv - Genetics 2019Quote: ... GoTaq Green Master Mix (Promega, WI) was used for amplification with the following PCR conditions were used ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... using GoTaq qPCR Master Mix (Promega). Standard curves for each gene were generated from serial dilutions of purified PCR products for each gene ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and GoTaq qPCR Master Mix (Promega) in a volume of 10 μL ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and GoTaq qPCR Master Mix (Promega), with Tc-RpS3 as the reference gene ...
-
bioRxiv - Genetics 2021Quote: ... 1X GoTaq® Master Mix (PROMEGA), and 2 μM of each primer ...
-
bioRxiv - Plant Biology 2021Quote: ... and GoTaq® Master Mix (Promega). Primers used are provided in Supplementary Table 11 ...
-
bioRxiv - Developmental Biology 2020Quote: ... using GOTaq qPCR Master Mix (Promega) or SYBR Green qPCR Master Mix (Life Technologies) ...
-
bioRxiv - Developmental Biology 2020Quote: ... using GoTaq qPCR Master Mix (Promega) with validated gene-specific primers (Supplementary Table 4) ...
-
A pancreas specific Ptf1a-driven Cre mouse line causes paternally transmitted germline recombinationbioRxiv - Genetics 2020Quote: ... GoTaq® Green Master Mix (Promega) is used ...