Labshake search
Citations for Promega :
301 - 350 of 1320 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... qPCR was performed using GoTaq® qPCR Master Mix (A6001, Promega). Primer sequences are listed in Table S1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, Cat# A6102) on CFX96 thermal cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 2× GoTaq q-PCR master mix (Promega, USA) and 0.6 μM of AF77/78 or AF79/80 primer pairs targeting a region close to the Cori or to the terminus (ter) ...
-
bioRxiv - Cell Biology 2019Quote: ... and human samples were performed using GoTaq green master mix (Promega) and the following amplification conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... in the GoTaq®qPCR Master Mix (Promega, Madison, WI, USA), before being deactivated at 95°C for 10 min ...
-
bioRxiv - Neuroscience 2020Quote: ... The DNA amplification was performed using GoTaq qPCR Master Mix (Promega) and carried out on a Real-Time PCR System (StepOne ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using GoTaq qPCR Master Mix (Promega, WI, USA) with StepOne Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2021Quote: ... RT-PCR was carried out using GoTaq Green Master Mix (Promega), following recommended protocol ...
-
bioRxiv - Microbiology 2020Quote: ... followed by amplification using GoTaq colorless Master Mix (Promega, Madison, WI) (36) ...
-
bioRxiv - Neuroscience 2023Quote: ... qRT-PCR was performed with GoTaq qPCR Master Mix (Promega, A6002) and a Quantstudio5 Real-Time PCR Detection System (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed using GoTaq qPCR Master Mix (Promega, #A6001) with primers:
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR (qPCR) was performed using GoTaq qPCR Master Mix (Promega). The primers used for Lrp6 were ...
-
bioRxiv - Molecular Biology 2023Quote: ... two reactions containing 40 μL TnT SP6 Quick Master Mix (Promega), 2 μL of 1 mM methionine and 1 μg of pCMV-Sport were incubated for 90 minutes at RT ...
-
bioRxiv - Microbiology 2022Quote: ... A master mix of transfected cells with 1x Endurazine™ (Promega) and 1 µM DrkBiT peptide (VSGWALFKKIS ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR amplification was performed using GoTaq® Master Mix (Promega, M7122), with the following conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed using GoTaq Green Master Mix (Promega, M7123). 2 µl of diluted cDNA was added to 12.5 µl GoTaq Green Master Mix and 0.4 µM of forward and reverse primers and nuclease-free water in a 25 µl reaction ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... qRT-PCR was conducted with the GoTaq qPCR Master Mix (Promega) at a total volume of 10 µl in an ABI 7500 Fast Real Time PCR cycler (Applied Biosystems) ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCRs were performed with GoTaq ® qPCR Master mix (Promega) with the following primer sets ...
-
bioRxiv - Biochemistry 2023Quote: ... using the GoTaq® qPCR Master mix (Promega, Madison, WI, USA). Bio-Rad CFX Manager software was used for data acquisition and analysis (version 3.1 ...
-
bioRxiv - Physiology 2023Quote: ... Reagents from the Promega GoTaq qPCR Master Mix kit (A6001, Promega) were used to perform qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... using GoTaq® Probe qPCR Master Mix (Promega, Madison, WI, USA) and the CDC 2019-Novel Coronavirus (2019-nCoV ...
-
bioRxiv - Microbiology 2023Quote: ... The amplification was performed using GoTaq Long PCR Master Mix (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... qPCR was performed with the GoTaq qPCR Master Mix (Promega, #A6001) on a Quantstudio 3 Real-Time PCR System (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR was performed using GoTaq® Long PCR Master mix (Promega) and each reaction consisted of ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR was performed using the Go TaqTM Master Mix (PRM7123, Promega).
-
bioRxiv - Bioengineering 2023Quote: Yeast-colony PCR was performed using green GoTaq Master Mix (Promega) as per the manufacturer’s protocol (dx.doi.org/10.17504/protocols.io.bp2l69p95lqe/v1 ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA fragments were amplified using GoTaq master mix (Promega Cat #M7123). Plasmids were introduced into AMB-1 through conjugation and are listed in supplementary table S2.
-
bioRxiv - Physiology 2024Quote: ... 18 µl of PCR master mix which includes MM (Promega #xxx), 1ul of Forward/Reverse primers (10mM) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10 µl of GoTaq® qPCR Master Mix (Promega, Cat# A6002), and 0.5 µl of each respective forward and reverse primers ...
-
bioRxiv - Genetics 2024Quote: ... and 10 µL of power SYBR green PCR master Mix (Promega). The real-time qPCR was performed using a fluorescent quantitative detection system (FQD-96A ...
-
bioRxiv - Neuroscience 2023Quote: ... TRPV2 and TRPC3 using GoTaq Green Master Mix (Promega, Madison, USA) were performed ...
-
bioRxiv - Plant Biology 2023Quote: ... were performed using GoTaq G2 Green Master Mix (Promega, cat#M7822). Secondary validation of genotyping reactions was performed as needed using the Quick-DNA Plant/Seed Miniprep kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 1 µl of crude DNA lysate was used with 2x GoTaq Reaction Mix (Promega M7123) supplemented with 5% DMSO.
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative RT-PCRs were performed with the GoTaq qPCR Master Mix (Promega), 2% of cDNA per reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR was performed in triplicate with the GoTaq qPCR Master Mix (Promega) in a LightCycler 480 instrument (Roche ...
-
bioRxiv - Genetics 2022Quote: ... DNA (50 ng) was amplified using 1X GoTaq Green Master Mix (Promega), 0.8 μM oligonucleotides and 5% DMSO up to a volume of 20 μL ...
-
bioRxiv - Neuroscience 2021Quote: ... Real-time PCR analysis was performed with GoTaq qPCR master mix (Promega) on a CFX384 system (Bio-Rad) ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative real-time PCR was performed using GoTaq qPCR Master Mix (Promega) at 58oC annealing temperature on LightCycler480 instrument (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... and 10 μL GoTaq Probe qPCR master mix (Promega, Madison, WI, USA). The amplification protocol consisted of 50 cycles of denaturation at 95°C for 3 s and annealing and extension at 60°C for 20 s.
-
bioRxiv - Neuroscience 2021Quote: ... Real-time PCR analysis was performed with GoTaq qPCR master mix (Promega) on a CFX384 system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2022Quote: ... QPCR was performed with GoTaq® qPCR Master Mix (Promega, Madison, WI). QPCR primers sequence will be provided upon request ...
-
bioRxiv - Neuroscience 2022Quote: ... and GoTaq®aPCR Master Mix with SYBR green fluorescence (Promega, Germany). PCR primer sequences were retrieved from the Primer Bank database (Spandidos et al. ...
-
bioRxiv - Plant Biology 2022Quote: ... PCR followed standard conditions using GoTaq®Green Master Mix (Promega corp.), Ta= 58°C ...
-
bioRxiv - Cell Biology 2022Quote: Real-time PCR was performed using the GoTaq qPCR Master Mix (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time PCR was performed using GoTaq PCR Master Mix (Promega) or PowerUp SYBR Green Master Mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Genomic PCR was carried out using GoTaq HotStart Green Master Mix (Promega), as per manufacturer’s instruction (TRAIP F ...
-
bioRxiv - Cell Biology 2021Quote: ... 60°C for 1 minute) using Go-Taq qPCR Master Mix (Promega) on a QuantStudio™ 7 Flex Real Time PCR System (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... containing 13.5 μL of GoTaq Green Master Mix (Promega, Cat No.: M7123), 1.5 μL of Human GAPDH Forward Primer (5’– AGAAGGCTGGGGCTCATTTG–3’) ...