Labshake search
Citations for Promega :
401 - 450 of 4890 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... We extracted genomic DNA from whole blood using a Wizard® Genomic DNA Purification Kit (#A1120, Promega Corp., Madison, USA) and then performed IPATS-BLV ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (2000 g x 5 min) and subjected to genomic DNA (gDNA) extraction using the Wizard Genomic DNA Purification kit (Promega), according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The bacterial cells were collected from 2mL of the culture and the genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega). Samples were then sent to Novogene Co. ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid carrying cells were cultured overnight in DM250 supplemented with 50 μg/ml kanamycin and DNA isolated using a Wizard Genomic DNA Purification Kit (Promega). Amplification of target genes was carried out using a SYBR Green based qPCR mix consisting of Q5® High-Fidelity 2× Master Mix (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... The bacteria were pelleted by centrifugation and DNA extraction was performed with the Wizard® genomic DNA purification kit (Promega).
-
bioRxiv - Plant Biology 2023Quote: ... Leaf samples of the high dyad producing plants were stored at -80°C before DNA extraction with the Wizard genomic DNA purification kit (Promega). A pooled DNA sample (equal mass ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 1 uL of the genomic DNA extracted using a Wizard Genomic DNA Purification Kit according to the manufacturer’s instructions (A1120, Promega USA), 1 uL Q5 high-fidelity DNA polymerase ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We isolated and purified genomic DNA from 1 mL of the overnight cultures using the Wizard DNA purification kit (Promega). Short-read sequencing (2 x 150bp paired-end reads ...
-
bioRxiv - Microbiology 2023Quote: ... Total genomic DNA was extracted from the mid-log culture using the Wizard® Genomic DNA Purification Kit from Promega following the manufacturer’s protocol.
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from overnight cultures on GCB agar plates with appropriate components using Wizard Genomic DNA purification kit (Promega) following manufacturer instructions.
-
bioRxiv - Microbiology 2020Quote: The biomass recovered from isolate incubation in broth medium was subjected to DNA extraction using the commercial kit Wizard® Genomic DNA Purification Kit (Promega Corporation, Madison, WI, USA), following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... from freshly frozen brain tissues or the Wizard genomic DNA purification kit (Promega, Madison, WI, USA) from blood according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... DNA from FFPE material was extracted Maxwell® 16 LEV RNA FFPE Purification Kit (Promega, AS1260).
-
bioRxiv - Microbiology 2020Quote: ... and the pellets were used for gDNA isolation with the Wizard Genomic DNA Purification Kit (Promega) as described previously (Liu et al. ...
-
bioRxiv - Cell Biology 2020Quote: Genomic DNA was extracted from primary fibroblasts using a commercial purification kit (Promega, Madison, WI, USA). DNA was store in TE (10 mM Tris ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant was discarded and gDNA was extracted using the Wizard Genomic DNA purification kit (Promega) according to vendor’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and isolation of gDNA was carried out with a Wizard Genomic DNA Purification Kit (Promega, USA) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Plasmids were purified from these cultures using a Wizard Plus SV Miniprep DNA Purification kit (Promega). All inserted sequences were confirmed by Sanger sequencing using M13 forward and reverse primers (M13F and M13R ...
-
bioRxiv - Microbiology 2022Quote: Viral genomes or gDNA from infected amoebas were purified using Wizard genomic DNA purification kit (PROMEGA). To determine the amplification kinetic ...
-
bioRxiv - Genomics 2023Quote: ... The single-stranded DNA generated using this method was purified using PCR purification kit (A9285; Promega) and quantified using Nanodrop ...
-
bioRxiv - Physiology 2023Quote: ... The gDNA was isolated from cell pellets using the Wizard Genomic DNA Purification kit (Promega, A1120). Preparation and Illumina short read sequencing (PE 150 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Purification was performed to remove adaptors and primer dimers using the Wizard Genomic DNA Kit (Promega) and quality was verified by measuring the quantity and length of the fragments ...
-
bioRxiv - Microbiology 2019Quote: Bacterial plasmid DNA was isolated with Wizard miniprep DNA purification system (Promega). Fungal genomic DNA isolation and Southern blot analysis were performed following standard procedures (Sambrook 2001) ...
-
bioRxiv - Microbiology 2019Quote: ... from 25 randomly selected CM samples was extracted by an automated Maxwell 16 DNA extraction platform using blood DNA purification kits (Promega, UK) following previously described protocols2 ...
-
bioRxiv - Plant Biology 2019Quote: ... 1 g of fresh leaves were collected from each genotype and DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega, USA) following manufacturer instructions ...
-
bioRxiv - Genomics 2022Quote: ... The liquid cultures were centrifuged at 10,000 rpm and DNA was extracted from the pelleted cells using Wizard DNA purification kit (Promega, Madison, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from 5 mL of overnight cultures using the Wizard Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) and DNA concentration was measured using a Qubit™ Fluorometer and Nanodrop 2000 (Thermo Scientific ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA of all the pOXA-48 bearing strains was isolated using the Wizard genomic DNA purification kit (Promega, WI, USA), and quantified using the QuantiFluor dsDNA system (Promega ...
-
bioRxiv - Plant Biology 2019Quote: ... Grown cultures were used for DNA isolation using Wizard Genomic DNA Purification Kit following the manufacturer’s instructional manual (Promega, Madison, WI).
-
bioRxiv - Genomics 2021Quote: ... the strain was cultivated on PD2 medium as described (Su et al., 2016) for DNA extraction using Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2020Quote: Molecular confirmation of HDR-mediated target site integration of the Reckh cargo was performed on genomic DNA extracted from single GFP+ black-eyed individuals using the Wizard® genomic DNA purification kit (Promega). Primers Kh1-ext-fw (CACTGTTGGCACTCCATCTG ...
-
bioRxiv - Genomics 2021Quote: ... small leaves and witches’ broom) (Figure 1B) were collected for total genomic DNA extraction using the Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from the aerial portions of 10-day old seedlings using the Wizard® Genomic DNA Purification Kit (Promega) following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... H12) of each 96 well plate were pooled prior to DNA extraction using Wizard Genomic DNA purification kit (Promega, Madison, Wisconsin). The P0 region including the beginning of galK was amplified for 25 PCR cycles using primers deep_seq_Fw and deep_seq_Rv carrying 5’ adaptors for Illumina sequencing ...
-
bioRxiv - Microbiology 2023Quote: ... One aliquot was used for DNA extraction using the Promega Wizard® Genomic DNA Purification kit (Promega Corporation, Madison, WI, USA) as per the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... 3 ml overnight cultures were subjected to DNA extraction using an automated Maxwell® 16 Tissue DNA purification kit and following the manufacturer’s instructions (Promega, UK). For long-read complete genome analysis ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA was prepared from single cell suspensions of thymic leukemias using the Wizard Genomic DNA Purification Kit (Promega, Madison WI). PCR amplification of the Jak3 pseudokinase domain was performed using MyTaq HS Red Master Mix (FroggaBio ...
-
bioRxiv - Microbiology 2023Quote: ... We used 1 ml of cultures and isolated the genomic DNA using the Wizard Genomic DNA Purification Kit (Promega; Madison, WI). We used the DNA with the Illumina DNA Prep kit (Illumina ...
-
bioRxiv - Microbiology 2024Quote: Final library purification was performed using the ProNex Size-Selective DNA Purification System (Promega, NG2001) and eluted in water before libraries pooling and sequencing using a paired-end 150 method on a Illumina NovaSeq System by Novogene.
-
bioRxiv - Genomics 2020Quote: DNA was extracted from the fin clips of the challenged fish using a commercial kit (Wizard Genomic DNA Purification Kit, Promega), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... or Wizard PCR purification kit (Promega), and then directly sequenced using the same and internal primers on an ABI 3130xl sequencer.
-
bioRxiv - Evolutionary Biology 2021Quote: Genomic DNA was extracted from about 20 mg of muscle tissue using the Wizard® Genomic DNA Purification kit (Promega, WI, USA) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... genomic DNA was extracted from an overnight culture of PS1793 using a Promega Maxwell Cell DNA Purification Kit (Promega Corp., Madison, WI). For short-read sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted from 1.5□mL of that culture by using a Wizard genomic DNA purification kit (Promega, Madison, WI, USA), prepped using the Nextera XT kit ...
-
bioRxiv - Microbiology 2020Quote: ... Positive clones were cultured in liquid LB medium supplemented with kanamycin (50 μg mL−1) for extraction of plasmid DNA with the Wizard Plus SV Minipreps DNA Purification System Kit (Promega - Madison, USA). Plasmids with unique EcoRI/HindIII restriction patterns were subjected to re-transformation and phenotypic confirmation by streaking the clones in solid LB medium supplemented with kanamycin (50 μg mL−1) ...
-
bioRxiv - Physiology 2022Quote: ... DNA was isolated from snap-frozen ACA tissues with the Maxwell® 16 Tissue DNA Purification Kit (#AS1030, Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: Genomic DNA was extracted from whole blood obtained from GALA II study subjects using the Wizard Genomic DNA Purification kits (Promega, Fitchburg, WI), and DNA was quantified by fluorescent assay ...
-
bioRxiv - Plant Biology 2019Quote: Extraction of genomic DNA from infected and healthy plant materials was performed using the Wizard Genomic DNA purification kit (Promega, Madison, WI); DNA was isolated from bacterial cultures using the Ultra Clean Microbial DNA Isolation kit (Mo Bio. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Evolved strains were thawed and grown overnight in 150 ml of liquid medium and DNA was extracted using the Wizard Genomic DNA Purification Kit from Promega (WI, USA). One DNA sample (20 to 60 µg ...