Labshake search
Citations for Promega :
501 - 550 of 4890 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: gDNA samples for library preparation were extracted from overnight LB cultures using the Wizard Genomic DNA Purification kit (Promega) as described above ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 0.5 ml (approximately 2 × 109 cells) were used for gDNA extraction with the Wizard Genomic DNA Purification kit (Promega), which typically yielded 50 μl of 0.5-1.5 μg/μl gDNA.
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
Throat colour polymorphism in relation to sex and body size of the Litter skink, Lankascincus fallaxbioRxiv - Zoology 2022Quote: ... black and white throat colored individuals using Promega Wizard® genomic DNA purification kit (Promega Corporation, Madison, Wisconsin, USA) following manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... lactis CICC 6242 strain producing nisin A was extracted using a “Wizard Genomic DNA Purification” kit (Promega, Madison, USA). The nisA and nisRK genes were amplified through a polymerase chain reaction using the primers listed in Table 1 [29] ...
-
bioRxiv - Synthetic Biology 2024Quote: DNA purification from agarose gel was done using Wizard SV Gel and PCR Clean-Up System Kit from Promega as per manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2024Quote: DNA purification from PCR mixture was done using Wizard SV Gel and PCR Clean-Up System Kit from Promega as per manufacturer’s instructions.
-
bioRxiv - Biophysics 2022Quote: ... and subsequently purified by gel purification kit (Promega).
-
bioRxiv - Molecular Biology 2020Quote: ... and isolated using Promega Wizard Plus Miniprep DNA Purification (Promega# A1460). The pU6-2-gRNA plasmid was cut with BBSI-HF restriction enzyme (Fisher Scientific Catalog# NC1222468 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Cell Biology 2023Quote: ... and DNA purification using a Wizard SV 96 plasmid system (Promega) before Sanger sequencing (Genewiz ...
-
bioRxiv - Neuroscience 2019Quote: Genomic DNA from ear biopsies was purified with Wizard® SV Genomic DNA Purification System (Promega) and 0.1 µg was used for real-time qPCR amplification with primers 5’ – TCTTTGTGCAAGGCCTGGGT – 3’ and 5’ – TAATCATGGGCTGTCCCGTT – 3’ targeting human FUS in the transgenic cassette ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the plasmid DNA was purified using the Wizard Plus SV Minipreps DNA Purification System (Promega) or QIAGEN Plasmid Midi kits.
-
bioRxiv - Microbiology 2019Quote: ... and DNA extraction and purification were performed in a Maxwell® 16 DNA extraction system (Promega) using the LEV DNA kit (AS1290 ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid miniprep DNA isolation was performed using Wizard Plus SV Minipreps DNA Purification System (Promega, USA). Plasmid maxiprep DNA isolation was performed using NucleoBond Extra Maxi Plus EF Kit (Macherey-Nagel ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and from the interior tissue (at least 2 mm away from the outermost edge of the specimen) using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: ... instrument was configured with the Standard Elution Volume (SEV) hardware and using the Maxwell 16 Cell DNA purification kit (Promega). For total RNA isolation ...
-
bioRxiv - Molecular Biology 2020Quote: Preserved tissue (10-15 mg) was used for nucleic acid purification by employing the Wizard genomic DNA kit (Promega, USA) and following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was extracted from selected clones as well as in the parental clone using the Wizard Genomic DNA Purification Kit (Promega). NGS was performed using Nextera XT DNA Library Preparation kit and the NextSeq 500 sequencing systems (Illumina ...
-
bioRxiv - Evolutionary Biology 2019Quote: DNA was extracted from stickleback fin clips using the Wizard® SV Genomic Purification kit (Promega® Corp., Madison, USA) and quantified using Picogreen® ds DNA assay (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2019Quote: ... Lifted cells were resuspended with an additional 50 µl of DMEM before adding to 50 µl Nuclei Lysis Buffer (Wizard Genomic DNA Purification kit; Promega) and frozen at −20°C overnight ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and from the interior of the sponge tissue (<2mm from the exterior pinacoderm) and the seawater filter papers using the Wizard Genomic DNA Purification Kit (Promega).
-
bioRxiv - Microbiology 2020Quote: gDNA was extracted from stationary phase evolved cocultures following revival from frozen stocks using a Wizard Genomic DNA purification Kit (Promega). DNA fragment libraries were constructed for samples from shaking WT-based cocultures A-F and NifA*-based cocultures M-R at generation ∼146 using NextFlex Bioo Rapid DNA kit ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA was extracted from loopfuls of pure MTBC colonies grown on Lowenstein-Jensen media (37) using the Maxwell 16 DNA Purification Kit (Promega). DNA from Nigerian strains was extracted using the Cetyl trimethylammonium bromide (CTAB ...
-
bioRxiv - Cancer Biology 2021Quote: ... The desired PCR fragments were isolated from a 1% agarose gel and purified using the Wizard Genomic DNA Purification Kit (Promega). In order to identify the specific edition ...
-
bioRxiv - Genetics 2020Quote: ... Using the primers provided in Supplementary Table 3 we performed PCRs on 40 ng of genomic material extracted from wild type mosquitoes of the G3 strain using the Wizard Genomic DNA purification kit (Promega). The primers were modified to contain suitable Gibson assembly overhangs (underlined ...
-
bioRxiv - Genetics 2020Quote: ... They were grown to adulthood and their gDNA was individually extracted using either the Wizard Genomic DNA purification kit (Promega) or the DNeasy Blood & Tissue Kit (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Genomic DNA from the 20 renal cortical tissues procured from the NIH NeuroBioBank were isolated using Wizard genomic DNA purification kit (Promega). The following forward (CCACAAGGGCAGAAAGTATG ...
-
bioRxiv - Microbiology 2021Quote: ... n=4 vaginal) and rUTI (n=3 urine) cohorts belonging to B2 phylogenetic group was extracted (Wizard Genomic DNA Purification Kit, PROMEGA) and sequenced by Illumina NovaSeq 2×150 nt ...
-
bioRxiv - Microbiology 2020Quote: ... glacialis A3 by filtering cells onto a 3-μm polycarbonate filter and using the Wizard SV Genomic DNA Purification kit (Promega) following the manufacturer’s instructions and quantified on a Qubit 3.0 fluorometer using the DNA high sensitivity assay kit (Thermo-Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: Genomic extraction for the WT C6706:str2 strain and each of the resistant mutants was performed using Wizard Genomic DNA Purification Kit (Promega). The concentration of DNA was quantified using Nanodrop spectrophotometer (ND-1000) ...
-
bioRxiv - Genomics 2023Quote: DNA was extracted from the agar/cell mixture from the output and control pools using a Wizard Genomic DNA Purification Kit (Promega). The manufacturer’s protocol was followed with two modifications ...
-
bioRxiv - Genetics 2023Quote: High molecular weight DNA was isolated from spleen tissue of a single male from each of the 11 imported Nachman wild-derived inbred strains using the Wizard DNA Purification Kit (Promega) or the Monarch HMW DNA kit (NEB ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Genomic DNA was isolated and purified using the Wizard Genomic DNA Purification Kit protocol for Gram negative bacteria at one-third volume (Promega), then quantified using SYBR Green I Nucleic Acid Stain (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: Aliquots of the final populations were thawed and the gDNA was extracted using the Wizard Genomic DNA Purification Kit (Promega). Briefly ...
-
bioRxiv - Synthetic Biology 2023Quote: DNA (genomic DNA pool and plasmid DNA pool) was isolated from the cell library using Wizard SV DNA purification system (Promega) for determining genome engineering efficiencies ...
-
bioRxiv - Molecular Biology 2023Quote: ... the RNA/Protein Purification Plus kit (Norgen, Thorold, ON, Canada) or the Maxwell 16 LEV simplyRNA purification kit (Promega, Madison, WI, USA) according to the manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... genomic DNA was extracted from ear punch biopsies using the Wizard SV Genomic DNA Purification System (Promega), and PCR was performed using Herculase II Polymerase (Agilent).
-
bioRxiv - Plant Biology 2020Quote: ... The isolation of plasmid DNA was performed with the Wizard Plus SV Minipreps DNA Purification System (Promega). The insert of the purified plasmid DNA was sequenced using the standard primers T7 and SP6.
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmid DNA was isolated by means of the Wizard® Plus SV Minipreps DNA Purification system (Promega). E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Genomic DNA was extracted from the different clones using the Wizard SV Genomic DNA Purification System (Promega). The DAP5 locus was PCR amplified and Sanger sequencing of the targeted genomic regions indicated two frameshift mutations in exon 10 (172 bp deletion in exon/intron 10 ...
-
bioRxiv - Microbiology 2020Quote: ... coli using a Wizard® Plus SV Minipreps DNA Purification System (Promega). C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA was purified following the column-based purification protocol (A1460, Promega). The set of different primary antibodies used in the ChIP assays are mentioned below:
-
bioRxiv - Cancer Biology 2022Quote: ... These cultures underwent Wizard Plus SV Minipreps DNA purification System (Promega, #TB225). This is carried out by production of clear lysate ...
-
bioRxiv - Bioengineering 2023Quote: ... Wizard® SV 96 Plasmid DNA purification system (Promega, Madison, WI, USA) was used for plasmid isolation ...
-
bioRxiv - Genetics 2021Quote: ... of G1 and G2 mosquitoes fluorescently expressing the actin5c::eCFP construct was extracted as individual samples using the Wizard® Genomic DNA Purification Kit (Promega). Regions of gDNA were then amplified according to the three primer pairs as indicated in Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... liquid cultures were pelleted at 3000 g for 10 minutes and miniprepped using the Tecan Fluent robotic liquid handler with Promega Wizard SV 96 Plasmid DNA Purification Kit (Promega; A2250).
-
bioRxiv - Cancer Biology 2022Quote: ... GB02 and GB03 using the Maxwell® 16 Instrument with the Maxwell® 16 Tissue DNA Purification Kit (Promega, Madison, WI). DNA concentration was determined using the Qubit Fluorometer (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: DNA extraction was also done for all the samples using the Wizard® Genomic DNA Purification Kit according to the manufacturer’s protocol (Cat#A1120, Promega USA).The eluted DNA was quantified by QuantusTM Fluorometer® (Cat# E6150 Promega Technologies ...
-
bioRxiv - Genetics 2019Quote: RNA was isolated from single pupal terminal samples dissected at 24 hours APF or 28 hours APF using the Maxwell® 16 Tissue DNA Purification Kit (Promega). Poly-A RNA-seq libraries were generated using a Clontech library preparation kit (040215) ...