Labshake search
Citations for Promega :
601 - 650 of 4631 citations for 7 CHLORO 2H PYRIDO 3 2 B 1 4 OXAZIN 3 4H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Microbiology 2022Quote: ... a one-fifth volume of CellTiter 96 AQueous One Solution Cell Proliferation Assay (G3580, Promega) was added to DMEM/Pen/Strep containing 2% FBS and incubated for 2 h ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... nuclei from HepG2 cells were isolated by incubating cell pellets in 500 μl of a hypotonic buffer for 15 min on ice (20 mM Tris-HCL, pH 7.4, 10 mM NaCl, 3 mM MgCL2, with protease and phosphatase inhibitor cocktail from Promega). Triton X-100 detergent was added to a 0.5% v:v final concentration to lyse the cells followed by centrifugation at 1200 × g for 10 min to pellet nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Immunology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately O/N using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Molecular Biology 2019Quote: ... 200 µg lysate was mixed with 0.1 µl RNase A (~3 mg/ml) and increasing concentrations of RNasin (Promega), as indicated ...
-
bioRxiv - Pathology 2021Quote: ... Cytopathic effects of the virus were measured after 3 days using the CellTiter-Glo luminescent cell viability assay (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Cell Biology 2020Quote: ... The sample was first treated by 2.5 μg of LysC (Wako) for 3 h at 37 °C with shaking and then treated with 2.5 μg of Trypsin (Promega) for over-night at 37 °C with shaking ...
-
bioRxiv - Bioengineering 2021Quote: ... on a 3.5 cm glass-based dish were transfected with 1.0 μg of EBFP (plasmid DNA) using 3 μL of FuGENE HD Transfection Reagent (Promega) in 10 μL of Opti-MEM (Life Technologies Corporation) ...
-
bioRxiv - Microbiology 2021Quote: ... and NS1 (3′) sequences were determined from purified product cloned into the pGEM-T vector by TA-cloning (Promega) according to the manufacturer’s guidelines.
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately overnight using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were diluted 10-fold with 25 mM ammonium bicarbonate and digested with 3 µg of trypsin (Promega, v5111) overnight at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Imaging was performed 3 min after intraperitoneal (i.p.) injection of 150 mg/kg D-Luciferin (Beetle Luciferin Potassium Salt, Promega) in the IVIS® Spectrum In Vivo Imaging System under 2.5% isoflurane inhalation anesthesia using 15 min exposure ...
-
bioRxiv - Molecular Biology 2023Quote: ... After 3 days the cells were washed with PBS and lysed with Cell Culture Lysis Buffer (Promega cat. #E1531) prior to firefly and Renilla luciferase activity measurements which were performed in triplicate using the Dual-GLO kit (Promega cat ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of lenti-viral transfer plasmids previously described along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Probe synthesis reactions were performed at 37 °C for 3 h and then were treated with DNase I (Promega) at 37 °C for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were seeded onto acid-washed coverslips at a density of 3 × 104 cells per coverslip for 24 h before transfection with 1μg of plasmid DNA using 3 μl Fugene HD transfection reagent (Promega). HaloTagged AP-2 σ2 was visualized by adding Janelia Fluor 646-HaloTag ligand (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: ... RT-PCR was used to amplify the OGDH 3’UTR and sub clone it into pmirGLO vector (Promega, UK). 5 × 10^4 C2C12 cells were seeded into 12 well plates ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells for the luciferase assay were exposed to 100 μL of a 1:1 dilution of DMEM and luciferase substrate (ONE-Glo Luciferase Assay System, Promega), and luminescence from each well measured in a GloMax-96 Microplate Luminometer (Promega) ...
-
bioRxiv - Microbiology 2023Quote: The genes were cloned one by one into in pGEM-T Easy Vector (Promega, Madison, USA) and finally in pMG36e vector (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM isopropyl β-d-1-thiogalactopyranoside (IPTG; Promega) was added to each RNAi well for induction of dsRNA synthesis and plates were incubated for 3-4 hours at 30°C and 155 rpm ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2021Quote: ... MTS reagent (CellTiter96 AQueous One; Promega) was added and the optical density was read at 490 nm to assess viability.
-
bioRxiv - Biochemistry 2019Quote: ... Luciferase reagent (Promega One-Glo, E6120) was added to cells after compound treatment and incubated for 10 minutes according to manufacturer recommendations ...
-
bioRxiv - Systems Biology 2020Quote: ... ONE-GloTM Luciferase Assay System (Promega) and Renilla-Glo® Luciferase Assay System (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... using QuantiFluor ONE dsDNA kit (Promega) and library size was checked on the Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... using QuantiFluor ONE Lambda DNA (Promega) as a DNA standard ...
-
bioRxiv - Molecular Biology 2022Quote: ... or QuantiFluor ONE dsDNA System (Promega) using QuantiFluor ONE Lambda DNA (Promega ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... one volume of CellTiter-Glo (Promega) assay reagent was added to each well ...
-
bioRxiv - Microbiology 2023Quote: One step RT-PCR kit (Promega) was used ...
-
bioRxiv - Genetics 2023Quote: ... One microgram of Trypsin Gold (Promega) was added to each sample and incubated in an end-over-end mixer at 37°C for 16 hours ...
-
bioRxiv - Developmental Biology 2023Quote: ... The QauntiFluor ONE dsDNA System (Promega) is used to quantify the double stranded library ...