Labshake search
Citations for Promega :
451 - 500 of 4631 citations for 7 CHLORO 2H PYRIDO 3 2 B 1 4 OXAZIN 3 4H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... Sample B was treated with 1 µg/ml trypsin (Promega). Sample C was pre-treated with 1% Triton X-100 (EMD-Millipore ...
-
bioRxiv - Plant Biology 2023Quote: ... Sample B was treated with 1μg mL-1 trypsin (Promega). Sample C was treated with 1% Triton X-100 (TX100 ...
-
bioRxiv - Immunology 2023Quote: ... prepared by combining ONE-Glo™ EX Luciferase Assay Buffer with ONE-Glo™ EX Luciferase Assay Substrate in 1:1 ratio (Promega, USA). After measuring the signal of the Firefly luciferase in the GloMax® 20/20 Luminometer (Promega ...
-
bioRxiv - Developmental Biology 2020Quote: ... Digests were carried out in 4M urea 100mM HEPES with LysC (Wako, #121-05063, 1/100 (w/w) protease/substrates) for 3 h at 37C and subsequent trypsin digest (Promega, #V5280, 1/100 (w/w) protease/substrates ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were then diluted 1:7 in Glo Lysis Buffer (Promega) and incubated 1:1 for 5 minutes in the dark in opaque 96 well plates with NanoGlo Substrate freshly diluted 1:50 in NanoGlo Buffer (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Biochemistry 2024Quote: HEK293T cells were transfected in a 6-well plate with 1 μg ADGRG6 DNA and 3 μL transfection reagent Fugene 6 (Promega, PRE2693) at 60-70% confluency and incubated for 48 h ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 75 μL (1:1 volume) of One-Glo™ reagent (E6110, Promega) was added to each well ...
-
bioRxiv - Microbiology 2020Quote: ... Assays were harvested on day 3 using BrightGlo luciferase reagent (Promega, Madison, WI) and luminescence detected with a Victor luminometer (PerkinElmer ...
-
bioRxiv - Pathology 2019Quote: ... RNA (3 μg) was retro-transcripted by using M-MLV (Promega, Madison, WI). qPCR was performed in triplicate by using validated qPCR primers (BLAST) ...
-
bioRxiv - Biochemistry 2022Quote: ... ~2.5 μg recombinant bacmid DNA and 3 μl FuGENE HD Transfection reagent (Promega) in 100 μl Sf900 II media (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were embedded in 3% low melting point agar (Promega, Madison, WI, USA). Formalin embedding ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 3 μg of DNA using FuGENE HD (Promega; E2311). Cells
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were tested for mycoplasma every 3 months with the Mycoalert kit (Promega), and identity was confirmed by STR profiling (DFCI molecular diagnostics laboratory) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and incubated at 37 °C for 3 h with Trypsin/Lys-C (Promega) at a 25:1 protein:protease ratio (w/w) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... plates were dispensed with 3 µL of CellTiter-Glo® (Promega, Madison, WI), centrifuged for 15 seconds at 1,000 RPM’s ...
-
bioRxiv - Cancer Biology 2023Quote: ... and CTNNB1 exon 3 was amplified using GoTaqβ G2 Flexi DNA Polymerase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and pMRXIH together with 3×FLAG tag or HaloTag7 (N2701, Promega, Madison, WI). DNA fragments encoding ATG2A (NM_015104.3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and plates were incubated for 3 days after which CellTiterGlo (Promega, Madison, WI) was added according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA (3 μg) was retro-transcribed by using M-MLV (Promega, Madison, WI). qPCR was performed in triplicate by using validated qPCR primers (BLAST) ...
-
bioRxiv - Physiology 2023Quote: ... 3 mg of RNA was reverse-transcribed with M-MLV (Promega, Madison, WI). Quantitative PCR (qPCR ...
-
bioRxiv - Microbiology 2023Quote: ... After 3-minute incubation we added 30 µl of NanoGlo Luciferase substrate (Promega) per well and nano luciferase activity was measured by Centro XS3 LB 960 luminometer (Berthold Technologies).
-
bioRxiv - Biochemistry 2021Quote: ... free thiols were alkylated by iodoacetamide and proteins were sequentially digested with endoproteinase Lys-C (Wako, 1:100 enzyme-to-substrate ratio, 3 h at 37 °C) and trypsin (Promega, 1:50, overnight at 37 °C). Digested samples were desalted ...
-
bioRxiv - Microbiology 2019Quote: ... For transfection 0.5 or 2 µg of plasmid DNA in 25 or 200 µL serum-free medium were mixed with 1 or 4 µL of FuGENE HD transfection reagent (DNA to reagent ratio of 1:2, Promega, Mannheim, Germany) and incubated for 10 min at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Forty-eight hours later, cells were treated with Thapsigargin (100nM, 4h) and cells were resuspended in passive lysis buffer (Promega). Firefly and Renilla luciferase activities were measured using a dual-luciferase reporter assay system (#E1960 ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Microbiology 2019Quote: ... The next day they were transfected over 24 hours with a DNA-Fugene HD mixture at a ratio of 1 μg DNA to 3 μl Fugene (Promega, Southampton, UK) according to the manufacturer’s instructions (Western analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected with 1 µg of DNA diluted in 45 µl dMEM and then mixed with 3 µl ViaFect™ (Promega, USA) transfection reagent added and incubate for 20 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... approximately 200,000 HEK-293T cells were transfected with 1 μg of plasmid DNA complexed to 3 μL of FuGENE HD (Promega, Cat: E2311). 16-20 hours post transfection the cells were dissociated from the plastic using cell dissociation buffer (Gibco Cat ...
-
bioRxiv - Microbiology 2022Quote: ... The cell suspension was mixed 1:1 with ONE-GloTM Luciferse Assay Buffer (Promega), and the luminescence was measured with the Synergy HTX Multi-Mode Reader ...
-
bioRxiv - Microbiology 2020Quote: ... The beads were then washed 3 times and incubated with 30ul lysis buffer (Promega). Then 15μl of the lysate was used to measure bound NanoLuc activity.
-
bioRxiv - Biochemistry 2020Quote: ... and were harvested on day 3 by scraping into passive cell lysis buffer (Promega). Luciferase activity was then measured using a commercial dual luciferase assay kit (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each sample was cut into 3 slices and in-gel digested with trypsin (Promega) as previously described15 ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested overnight at 37 °C by addition of 3 μg trypsin (Promega) and 2 μg LysC (Promega) ...
-
bioRxiv - Immunology 2020Quote: For cloning the USP18 3’UTR in the psiCHECK2 vector (Promega, Madison, WI, USA), the first 559nt of USP18 3’UTR were amplified from cDNA of HeLa S3 treated with IFN using the primers USP183UTR_XhoI_FW and USP183UTR_NotI_RV ...