Labshake search
Citations for Promega :
151 - 200 of 6684 citations for 20 Hydroxyecdysone ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the plates were equilibrated to room temperature before ATP levels were measured with the CellTiter Glo kit (Promega) as the cell viability read-out ...
-
bioRxiv - Immunology 2021Quote: Plates were analyzed using the GloMax Explorer plate reader (Promega, Madison, WI) and GraphPad Prism (GraphPad Software version 9 ...
-
bioRxiv - Microbiology 2020Quote: ... the plate was read on a Glomax Multi Detection Plate Reader (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... the test plate was inserted in the plate reader GloMAX discover (Promega) to measure the luminescence by VSC stimulation ...
-
bioRxiv - Neuroscience 2019Quote: ... The luminescence of each sample was measured using a luminometer (GloMax 20/20, Promega) and normalized to total protein concentration using a Protein Assay Kit (#5000006 ...
-
bioRxiv - Microbiology 2021Quote: ... and then luciferase activity was measured using the Glomax 20/20 luminometer (Promega Co.). Infection assays were done in triplicate and were replicated 4 times ...
-
bioRxiv - Microbiology 2022Quote: ... and then luciferase activity was measured using the Glomax 20/20 luminometer (Promega Co.). Vero E6 and Vero-TMPRSS2 infection assays were replicated four times ...
-
bioRxiv - Molecular Biology 2022Quote: ... The assay was performed as per manufacturer’s protocol using luminometer (Promega Glomax 20/20) and data was analysed as stated in statistical analysis section ...
-
Spatial control of gene expression in flies using bacterially derived binary transactivation systemsbioRxiv - Genetics 2020Quote: ... which was then placed in the GloMax® 20/20 Luminometer (Promega, Madison, WI) to measure luminescence in relative luciferase units (RLU ...
-
bioRxiv - Molecular Biology 2020Quote: ... LUC activity was measured using a GloMax®20/20 Luminometer (Cat# E5311, Promega). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... Luciferase activity was measured using a Promega Glowmax 20/20 luminometer (Promega, Madison, WI) with a signal collection integration time of 2 s ...
-
bioRxiv - Molecular Biology 2023Quote: ... Luminescence was measured in a Promega™ GloMax® 20/20 Luminometer (Promega #E5311) with an integration time of 10 seconds.
-
bioRxiv - Microbiology 2024Quote: ... and the RLUs were quantified using the GLOMAX 20/20 luminometer (Promega, Madison, USA).
-
bioRxiv - Cancer Biology 2024Quote: ... 20 μl of cell lysate was added to 20 μl of Luciferase Substrate (Promega), rotationally mixed for 15 minutes at RT and luminescence quantified on a FLUOstar Omega plate reader (BMG Labtech) ...
-
bioRxiv - Microbiology 2021Quote: ... At 1 × s after injection of 20 µl of the substrate solution (Renilla Luciferase Assay System, Promega), relative light units (RLUs ...
-
bioRxiv - Immunology 2019Quote: ... at 37ºC for 1 hr followed by treatment with 20 µg proteinase K (Promega, Madison, WI, USA) at 45ºC for 1 hr to remove protein ...
-
bioRxiv - Genomics 2021Quote: ... Diluted cDNA (1:20) was used in a PCR reaction with the GoTaq qPCR Master Mix (Promega) and run on a CFX384 Touch instrument (Bio-Rad).
-
bioRxiv - Microbiology 2024Quote: ... Then 20 µL of 50 mM ABC containing 1 µg of trypsin (Promega Platinum Mass Spectrometry Grade) was added and the traps were incubated 2h at 47°C in a covered thermomixer without vortexing ...
-
bioRxiv - Cancer Biology 2019Quote: ... 20 µL of CellTiterGlo (Promega) was added to each well ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 20 U of RNasin (Promega) and 1 µg of Yeast RNA (Ambion ...
-
bioRxiv - Cell Biology 2019Quote: ... 327371000)/0.5%Tween-20 (Promega, H5151) for 5 min at RT followed by blocking in 5% BSA/PBS/0.001% Sodium Azide for 30 min at RT ...
-
bioRxiv - Genetics 2021Quote: ... and RNasin (20 units, Promega) were added in a total volume of 10 μl in 1X T4 PNK buffer (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... and 20 units RNasin (Promega). Ligation products were reverse transcribed into cDNA and amplified with the Access RT-PCR Kit (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... 20 units of RNAsin (Promega), 1 mM dNTPs ...
-
bioRxiv - Biochemistry 2022Quote: ... 20 ug/ mL chymotrypsin (Promega), 1 mM CaCl2 ...
-
bioRxiv - Genomics 2022Quote: ... The GloMax20/20 Luminometer (Promega) was used to measure dual luciferase (Renilla and Firefly) ...
-
bioRxiv - Genetics 2023Quote: ... 0.2% Tween-20 (Promega, #H5152) and PBS for 30 mins in a humid chamber humidified using PBS/0.2% Tween-20 at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction mixture was prepared into 96-well plates as follows: 1 μl of 1 mM amino acid mixture minus methionine (Promega, Cat: L9961), 35 μl of rabbit reticulocyte lysate ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed on the plate and incubated with luminescence glo regents per the luminescence glo assay kit’s instructions (Promega). Luminescence was recorded using a BioTek Synergy2 plate reader.
-
bioRxiv - Microbiology 2022Quote: ... Infected cells were incubated for approximately 18-20 hours and luciferase was measured using the Promega BrightGlo luciferase kit following manufacturers’ instructions (Promega). Entry signal was normalized to the average signal for the “no spike” control ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Genomic DNA from the 20 renal cortical tissues procured from the NIH NeuroBioBank were isolated using Wizard genomic DNA purification kit (Promega). The following forward (CCACAAGGGCAGAAAGTATG ...
-
bioRxiv - Biochemistry 2024Quote: Kinase activity was measured in a generic kinase reaction buffer (20 mM Tris pH 7.4, 50 mM KCl, 10 mM MgCl2) using the ADP-Glo assay kit (Promega, V6930) and on a commercial CK2 substrate peptide (EMD Millipore ...
-
bioRxiv - Microbiology 2024Quote: ... difficile strains carrying sLucopt reporter constructs was mixed with 20 µL of reconstituted Nanoglo substrate (50 fold diluted Nanoglo substrate in kit buffer, Promega) in a white ...
-
bioRxiv - Cell Biology 2020Quote: ... Luminescence was measured using a plate reader (Promega, GloMax Discover plate reader, GM3000). Relative viability was calculated by dividing luminescence values for each replicate by mean luminescence of media control for each experiment.
-
bioRxiv - Microbiology 2021Quote: ... and firefly luciferase activity was measured on a luminometer (GloMax 20/20, Promega, Madison, WI). Fold change over the parental pseudotyped viruses was calculated for each mutant pseudotyped virus.
-
bioRxiv - Molecular Biology 2022Quote: ... First, we added 20 uL 2X formamide denaturing solution (20% Glycerol, 80% Formamide (Promega # H5051), 60 mg/mL Bromophenol Blue ...
-
bioRxiv - Cancer Biology 2022Quote: ... and luminescence was measured by a GloMax® 20/20 Luminometer (Cat. No. E5311, Promega). To measure apoptotic activity ...
-
bioRxiv - Cell Biology 2023Quote: ... and luminescence was measured using a Promega GlowMax 20/20 Luminometer (Promega, Madison, WI, USA). Following luminescence measurements ...
-
bioRxiv - Immunology 2023Quote: ... and 120 min and measured again in the GloMax® 20/20 Luminometer (Promega, USA) to detect the NanoLucTM Luciferase ...
-
bioRxiv - Molecular Biology 2021Quote: 1 uL of pUG cDNA was then input into a 20 uL GoTaq PCR reaction (Promega; Cat # M7123) with the first adapter specific primer (Shukla et al. ...
-
bioRxiv - Biochemistry 2024Quote: ... were digested overnight at 37 °C using trypsin with a 1:20 trypsin to sample ratio (Promega, #V5117). The next day ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was read with a plate reader (GloMax® Discover Microplate Reader (Promega) or CLARIOstar Plus Microplate Reader (BMG Labtech) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were seeded in 96 wells plate and luciferase activities were measured using Dual-Luciferase Reporter Assay System kit as described by the manufacture (Promega). Fluc/Rluc ratios were determined as relative luciferase activities.
-
bioRxiv - Cancer Biology 2022Quote: ... for 72 hours and cell proliferation was assayed using the CellTiter 96 Non-Radioactive Cell Proliferation kit and a GloMax Discovery plate reader (Promega). For proteomic mass spectrometry ...
-
bioRxiv - Biochemistry 2023Quote: Cells were grown in opaque 96-well white plates and then processed according to the manufacturer’s instructions of the CellTiter-Glo Luminescent Cell Viability Assay kit (Promega # G9241). The standard curve of ATP was determined in parallel for absolute quantitation.
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from overnight cultures on GCB agar plates with appropriate components using Wizard Genomic DNA purification kit (Promega) following manufacturer instructions.
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Biophysics 2019Quote: ... were added and the luminescence was measured using a Glomax 20/20 Luminometer (Promega; Madison, WI) after a 10 s incubation ...
-
bioRxiv - Plant Biology 2022Quote: ... The DLR assay system was used with the GloMax 20-20 luminometer (Promega, Madison, WI, USA) to measure the relative luciferase (LUC ...
-
Metabolic switching and cell wall remodelling of Mycobacterium tuberculosis during bone tuberculosisbioRxiv - Microbiology 2022Quote: ... the cell lysate was pelleted and read for RLU using a luminometer (Promega GloMax 20/20).