Labshake search
Citations for Promega :
401 - 450 of 6347 citations for Human Glutamine Fructose 6 Phosphate Transaminase 1 GFPT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were transfected with plasmid DNA using Fugene 6 reagent (Promega) by following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2019Quote: ... cDNA transfections were performed using JetPEI (Polyplus Transfection) or Fugene 6 (Promega) transfection reagents according to manufacturers’ instructions for 24h ...
-
bioRxiv - Cell Biology 2019Quote: ... and 0.2 μg of pMD2.G envelope plasmid using FuGENE 6 (Promega). Cells were incubated up to 48 hrs and then lentivirus-containing media was collected and concentrated with Lenti-X concentrator (Clontech) ...
-
bioRxiv - Microbiology 2021Quote: RSV VLPs were produced by FuGENE® 6 Transfection Reagent (Promega, E2691) transfection of DF1s at 50% confluence with 1 µg of viral plasmid ...
-
bioRxiv - Immunology 2021Quote: ... and HIV Rev plasmid using Fugene 6 transfection reagent (Promega, Madison, WI). Virus-containing medium was titrated to ensure undersaturating conditions for infection of H1299 cells ...
-
bioRxiv - Cell Biology 2022Quote: ... For transient transfection cells were incubated with mixture of FuGene 6 (Promega) and the plasmid of interest ...
-
bioRxiv - Biochemistry 2022Quote: ... was mixed with 10 μL of FuGENE 6 transfection reagent (Promega E2693). After 5 minutes ...
-
bioRxiv - Immunology 2022Quote: ... into 293T cells in DMEM medium + 10% FCS using Fugene 6 (Promega) for pseudoviruses production ...
-
bioRxiv - Cancer Biology 2023Quote: ... along with the plasmid of interest using Fugene 6 transfection reagent (Promega). All shRNA plasmids used were purchased from Sigma ...
-
bioRxiv - Cell Biology 2023Quote: Plasmid DNA transfections were performed using FuGENE® 6 transfection reagent (Promega). Briefly ...
-
bioRxiv - Biochemistry 2023Quote: ... they were transfected with indicated plasmids using FuGENE 6 transfection reagent (Promega). After another 24h ...
-
bioRxiv - Microbiology 2023Quote: ... in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega). After overnight incubation at 37°C in 5% CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected using a master mix of Fugene 6 (Promega, E269A) and Optimem (Gibco ...
-
bioRxiv - Microbiology 2024Quote: ... HEK293T cells (70% confluent) were transfected using FuGene 6 transfection reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RT-qPCR reactions using the GoTaq 1-Step RT-qPCR kit (Promega) were set-up to 10 µl final reaction volumes according to the manufacturer’s instructions containing 250 nM of each receptors primer pairs and 10 ng of RNA ...
-
bioRxiv - Molecular Biology 2021Quote: The CD19 minigene was amplified from human genomic DNA (Promega) with the primers 5’-catAAGCTTgaccaccgccttcctctctg-3’ and 5’-catGAATTCNNNNNNNNNNNNNNNGGATCCttcccggcatctccccagtc-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the human CB1R was cloned into the pCI vector (Promega), and eCB2.0 and eCBmut were cloned into the peGFP-C1 vector (Takara) ...
-
bioRxiv - Immunology 2022Quote: ... and a β-globin calibration curve (human genomic DNA [Promega]) was concurrently evaluated on each plate ...
-
bioRxiv - Microbiology 2020Quote: ... The human codon-optimized NanoLuc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
The absence of C-5 DNA methylation in Leishmania donovani allows DNA enrichment from complex samplesbioRxiv - Molecular Biology 2020Quote: ... donovani BPK282/0 cl4 promastigote DNA with human DNA (Promega) from 1/15 to 1/150000 (Leishmania:human ...
-
bioRxiv - Biochemistry 2020Quote: hnRNP L and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L and SETD2 were constructed by PCR (Phusion polymerase ...
-
bioRxiv - Immunology 2020Quote: ... The human codon-optimized nanoluc Luciferase reporter gene (Nluc, Promega) was inserted in place of nucleotides 1-100 of the nef-gene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Serial dilutions of genomic DNA from human placenta (G1471, Promega) were used as a standard for quantification and their concentration.
-
bioRxiv - Microbiology 2022Quote: ... falciparum 3D7 DNA with commercially available human DNA (Promega, G304A) to a total amount of 400ng DNA ...
-
bioRxiv - Neuroscience 2024Quote: Human male genomic DNA obtained from Promega (Ref:G1471; Madison, WI) was used to generate the input library ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates were prepared by addition of 0.3N hydrochloric acid then 450nM Tris (pH=8) and metabolites were analyzed using the Glutamine/Glutamate Glo Assay (Promega; J8021) per manufacturer’s instruction.
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA and siRNA transfections were performed using FuGENE 6 Transfection Reagent (Promega) and Lipofectamine RNAiMAX (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected with either Cmas or Slc35a1 DNA using FuGene 6 (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... They were then transfected with pEYFP-XRCC1 (1µg) and 6µl Fugene 6 (Promega) in Optimem (Gibco ...
-
bioRxiv - Cancer Biology 2021Quote: ... FuGENE 6 transfection reagent and CellTiter-Glo assay system were obtained from Promega. SMARTpool siGENOME siRNA targeting NTC ...
-
bioRxiv - Biophysics 2020Quote: ... epsin 1WT-EGFP or epsin 1R114A-EGFP using Fugene 6 transfection reagent (Promega). For the fluorescent uptake assays ...
-
bioRxiv - Cell Biology 2021Quote: ... 1.5 μg total DNA was combined with 4.5 μL FuGENE 6 (Promega E2691) pre-complexed in 100 μL serum-free DMEM ...
-
bioRxiv - Genetics 2022Quote: ... HEK cells were transfected with 500 ng of plasmid using FuGENE 6 (Promega) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... and target (400 ng) plasmids using 6 μL FuGene HD (Promega, Cat# E2311). 72 hrs later ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.8 μg targeting vector AAVS1-CAGGS-tdTomato using Fugene 6 transfection reagent (Promega). GFP and tdTomato double positive cells were sorted 3 days post transfection on a FACSAria (BD Biosciences) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transfections were performed by complexing plasmids with FuGENE® 6 Transfection Reagent (Promega) in OptiMEM media (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmid transfections were performed in MDA-T32 cell line using Fugene 6 (Promega). Transfected cells were cultured for over 3 weeks in complete RPMI-1640 medium containing G418 (600 μg/ml ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Retrovirus was produced through transfection of HEK293 cells using FuGENE 6 (Promega, E2692). Two days after transfection ...
-
bioRxiv - Molecular Biology 2024Quote: ... Trypsin digestion was performed at a concentration of 6 ng/μl (Promega, #V511A). Post-digestion ...
-
bioRxiv - Molecular Biology 2024Quote: ... 25,000 HEK293-T cells were seeded and transfected with FuGENE 6 (#E231A, Promega) and plasmid DNA at the carrier (µL):DNA (µg ...
-
bioRxiv - Biochemistry 2024Quote: ... were transfected with 2 µg of bacmid using Fugene 6 transfection reagent (Promega), as described by the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: HEK-293T cells were transfected using the FuGENE® 6 Transfection Reagent (Promega) following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Immunology 2022Quote: ... cells were washed 2 times with phosphate-buffered saline (PBS) and lysed with Luciferase Cell Culture Lysis 5x reagent (Promega, Madison, WI). Using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... luciferase assay reagent was mixed in a 1:1 ratio with cell lysate (Luciferase Assay System kit, Promega, Madison, WI). Luciferase activity was measured with Synergy H4 Hybrid Reader (BioTek ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pooled human male DNA (G3041, Promega and 4312660, Life Technologies) were used to generate calibration curves and serve as reaction controls ...