Labshake search
Citations for Promega :
251 - 300 of 6347 citations for Human Glutamine Fructose 6 Phosphate Transaminase 1 GFPT1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: hTert-RPE1 cells were transfected using FuGENE 6 (Promega) according to the manufacturer’s instructions at a ratio of 1:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the FuGENE 6™ (Promega, Fitchburg, WI, USA) transfection reagents according to the suppliers’ instructions for 1-2 days before the experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... then 6 μL FuGENE HD Transfection Reagent (Promega, USA) was added and vortexed to obtain a 3:1 reagent-to-DNA ratio ...
-
bioRxiv - Immunology 2022Quote: ... by transfection using Fugene 6 (Promega, catalog no. E2692) and a combination of S plasmid ...
-
bioRxiv - Immunology 2022Quote: ... and p MD.2G using Fugene 6 (Promega, PAE2693) in HEK293T cells ...
-
bioRxiv - Genetics 2022Quote: ... The transfection mix was prepared using Fugene 6 (Promega) at 3µl/ug DNA in 500µl (total volume ...
-
bioRxiv - Bioengineering 2020Quote: ... and 42 μL FuGENE 6 (Promega, Cat. No. E2691). The tube was gently flicked to mix the plasmids before and after the addition of FuGENE 6 ...
-
bioRxiv - Biochemistry 2020Quote: ... Transfections were carried out by using Fugene 6 (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FLAG-KrascomQ61R using FuGene 6 reagent (Promega, E2691) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... HEK293 cells were transiently transfected using Fugene 6 (Promega) with GFP-Tnf 3’UTR reporter constructs and a pGL3-mCherry control construct ...
-
bioRxiv - Cell Biology 2021Quote: ... Digestion was with 6 ng/μl trypsin (Promega, UK) overnight at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected using FuGENE 6 (Promega, Madison, WI) or lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 18 μl of FuGENE 6 transfection reagent (Promega), according to manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transfected using FuGENE® 6 reagent (Promega) combined with 12 μg of the indicated plasmid cDNA construct ...
-
bioRxiv - Microbiology 2023Quote: ... 6 washes were performed before adding the trypsin (Promega) at 1/20 ratio for 2h at 47°C ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... was combined with 9.6 μL FUGENE 6 (Promega #E2691) and incubated for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid DNA transfections were performed using FuGENE 6 (Promega), Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2.8 μL transfection reagent Fugene 6 (Promega, PRE2693). After a 24-h incubation ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction of samples was performed according to an adapted version of the “DNA purification from human feces using the Maxwell® RSC instrument and the Maxwell® RSC PureFood GMO and Authentication Kit” developed by Promega (Promega Corporation ...
-
bioRxiv - Microbiology 2022Quote: The extent of ADCC activation induced by human γ-globulins was evaluated with the use of an ADCC Reporter Bioassay (Core Kit; Promega, G7010) and the EnSpireMultimode Plate Reader (PerkinElmer) ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... in DEPC-treated phosphate buffer (PB) with 0.5% Triton X-100 supplemented with RNasin (Promega, Madison, WI). Sections were rinsed 3 × 10 min with DEPC-treated PB ...
-
bioRxiv - Microbiology 2020Quote: ... membranes were incubated in a 0.165 mg/ml BCIP (5-bromo-4-chloro-3-indolyl phosphate, Promega)/ 0.33 mg/ml NBT (p-nitroblue tetrazolium chloride ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). For siRNA tests ...
-
bioRxiv - Cell Biology 2023Quote: ... COS-7 cells were plated on 10 cm plates and transfected 24h prior to lysis using FuGENE 6 (Promega; 6-12 µg total DNA). Cells were routinely tested for mycoplasma using a MycoAlert detection kit (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... per 10 cm dish using Fugene 6 (Catalog# Promega# E2691), and the medium was changed after 8 hours using (IMEDM+10%FBS) ...
-
bioRxiv - Neuroscience 2019Quote: ... Proteins were digested with 6 ng/µl trypsin (Promega, UK) overnight at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: 293T cGAS ENPP1−/− cells were transfected with Fugene 6 (Promega) according to manufacturer’s instructions plus indicated concentrations of pcDNA3 plasmid DNA (empty or containing human ENPP1) ...
-
Weak Membrane Interactions Allow Rheb to Activate mTORC1 Signaling Without Major Lysosome EnrichmentbioRxiv - Cell Biology 2019Quote: ... 1.5 μl of Fugene 6 transfection reagent (Promega, Madison, WI) and 100 μl of OptiMEM (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... Plasmids were forward transfected into cells using FuGENE 6 (Promega). BEZ-235 ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmid transfections were performed with FuGENE 6 (Promega, cat#E2691) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Retroviral particles were generated using the Fugene 6 reagent (Promega) to simultaneously transfect subconfluent monolayers of 293T cells with 1μg pBABE (vector ...