Labshake search
Citations for Promega :
4151 - 4200 of 4270 citations for 7 Bromo 1 2 3 4 tetrahydronaphthalen 1 ol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: Cells infected with a luciferase-encoding virus were lysed 2 days after infection with a Bright-Glo Luciferase Assay System (E2620, Promega) and the luminescent signal was measured using a GloMax Explorer Multimode Microplate Reader (Promega).
-
bioRxiv - Immunology 2023Quote: Expression vectors encoding Foxp3 and Ikzf1 and/or Ikzf1 mutants were transfected into HEK293T cells (2 × 105) with FuGENE HD (Promega). 48h after transfection ...
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were washed 3 times by resuspending in cold PBS containing 2% fraction V bovine serum albumin and 0.2 U / µl RNase inhibitor (Promega, N2615). For multiome assay ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were starved by 50 μL Hank’s balanced salt solution for 30 min and then incubated in 50 μL CO2-independent media containing 2% GloSensor cAMP Reagent (Promega) for 1 hour ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 × 106 Sf9 cells in 2 mL of media in a 6-well dish were transfected with up to 2 µg of fresh bacmid DNA using FuGene HD transfection reagent (Promega) at a ratio of 3:1 (Fugene reagent:DNA ...
-
bioRxiv - Microbiology 2023Quote: ... Specific adapters 1 and 2 described in Table B were self-hybridized and then ligated to the ‘A’ tail ends by T4 ligase (Promega). After purification with AMPure XP purification kit (Agencourt) ...
-
bioRxiv - Biochemistry 2023Quote: ... proteins were diluted with 50 mM NH4HCO3 to a final concentration of 2 M urea and digested with trypsin (Promega), at an enzyme-to-substrate ratio of 1:20 ...
-
bioRxiv - Neuroscience 2023Quote: ... luminescence photons were collected by accumulating the image for 60 s in the presence of 2 mM D-luciferin (Promega), and the luminescence signal was measured from the same varicosities as the corresponding fluorescence image ...
-
bioRxiv - Biochemistry 2023Quote: ... then washed and resuspended in 2 M urea and trypsinized overnight with 0.5 μg/μl sequencing grade trypsin (Promega, V5111). Tryptic peptides were eluted off with spin columns (BioRad ...
-
bioRxiv - Cancer Biology 2023Quote: ... First-strand complementary DNA (cDNA) synthesis was performed using 2 μg of total RNA with M-MLV reverse transcriptase (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: The activity of EBV miRs-BART 7-3p and 9-3p was evaluated in Akata-EBV/Cas9 cells by luciferase reporter gene assay with constructs based on the psiCheck-2 backbone (Promega). 3’-UTR sequences with miRNA-binding sites (Supplementary Material ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNAs were detected with a YFP long probe (primers listed in Supplemental Table 2) labeled with 32P-dCTP prepared according to the manual of the Prime-a-Gene Labeling System (Promega). The blot was hybridized overnight at 42 °C with the probe before being washed with 2xSSC ...
-
bioRxiv - Microbiology 2023Quote: ... injecting 50 μl per well of coelenterazine substrate (Nanolight Technologies, 2 μg/ml) and analysing luminescence on a FLUOstar OPTIMA luminometer (Promega). Fold inductions were calculated by normalising to a mock-treated control.
-
bioRxiv - Evolutionary Biology 2023Quote: ... reverse transcription was performed using Promega’s Go-Taq 2-Step system with oligo(dT) and randomized primers as per manufacturer’s instructions (Promega, Madison, WI).
-
bioRxiv - Plant Biology 2023Quote: ... Purified DNA was run on 2% agarose gel and bands corresponding to ∼150 bp were cut and purified with a Gel Purification kit (Promega). Libraries were constructed using the Nugen Ovation Ultralow Library System V2 following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... gondii glyceraldehyde 3-phosphate dehydrogenase 2 (GAPDH2, ML5049/ML5680) or TgAPT1 (ML4097/ML4098) were used for subsequent PCR amplification with GoTaq polymerase (Promega) for twenty-five cycles as follows ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Systems Biology 2023Quote: ... The panel of ssDNA-labelled antibodies (250 ng/ml for each antibody) was mixed with 2 U/µl RNAsin Plus (Promega) and 0.1% Triton X-100 in PBS:PFBB (1:1 ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 4% FBS and 100 µL were seeded per well in 96-well plates at a density of 2×105 cells/mL in the presence or absence of 0.1 mM HaloTag NanoBRET™ ligand (Promega). The following morning ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega, cat# A6110). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR fragment was directionally cloned downstream of the Renilla luciferase ORF in the psiCHECK-2 vector (Promega, Madison, US) using the Quick Ligase kit (M2200 ...
-
bioRxiv - Cell Biology 2024Quote: ... 50 μL IVT reactions were carried out for 2 hours at 30°C using commercially available Nuclease-Treated Rabbit Reticulocyte Lysate (RRL, Promega) and reaction components were added in the following order ...
-
bioRxiv - Plant Biology 2024Quote: ... The sample solutions were diluted to a final concentration of 2 M urea and 50 mM ammonium bicarbonate prior to the trypsin (Promega) digestion ...
-
bioRxiv - Cell Biology 2024Quote: ... Bacmid DNA was extracted from overnight cultures using isopropanol precipitation as described.72 About 1 × 106 Sf9 cells in 2 mL of media in a 6-well dish were transfected with up to 2 μg of fresh bacmid DNA using FuGene HD transfection reagent (Promega) at a ratio of 3:1 (Fugene reagent:DNA ...
-
bioRxiv - Microbiology 2024Quote: In vitro toxicity was assessed in HeLa cells (ATCC® CCL-2) using the ApoTox-GloTM Triplex Assay (Promega, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: The 3’UTR of human Akt or Pin1 was amplified by PCR from fibroblast genomic DNA and cloned downstream of the Renilla luciferase gene in the psiCHECK-2 dual reporter construct (Promega) by XhoI (Akt ...
-
bioRxiv - Developmental Biology 2024Quote: ... Transfection for each well was performed with a mixture of 2 µg of DNA and 6 µL of Fugene HD reagent (Promega). The DNA/fugene mixture was incubated for 15 minutes at room temperature prior to its drop-wise addition to the infected culture ...
-
bioRxiv - Developmental Biology 2021Quote: ... abdomens were washed with phosphate-buffered saline with 0.1% Tween (PBST) four times for 15 minutes before RNase (Promega, original concentration of 4 mg/mL) was added in a concentration of 10 μL/mL for 20 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay as described previously [20] or by CellTiterGlo assay (Promega, Walldorf, Germany) following the manufacturer’s instructions after 120h incubation.
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...
-
bioRxiv - Zoology 2019Quote: ... Traces of genomic DNA were removed by treating 2 μg of the total RNA with RQ1 RNase-Free DNase (Promega, USA). First-strand cDNA was synthesised from RNA using the M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Molecular Biology 2020Quote: ... cell pellets were lysed in polysome lysis buffer (gradient buffer containing 100 mM KCl, 10 mM MgCl2, 0.1% NP-40, 2 mM DTT, and 40 U/ml RNasin; Promega, Leiden, Netherlands), and onto 17–50% sucrose gradients and ultracentrifuged for 2 h at 40,000 rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... the final volume was brought to 80 ml with Lysis Buffer+2 mM CaCl2 and incubated with 1000U of RQ1 DNase (Promega-PRM6101) for 30min at RT ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... The resulting protein extract was first diluted to 2M urea for overnight digestion with LysC (Wako, USA) at 37°C and then diluted 2-fold for 8 h digestion with trypsin (Promega, USA) at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...