Labshake search
Citations for Promega :
4101 - 4150 of 5345 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Cell Biology 2021Quote: ... RPE-1 cells were transfected with pX458 using Fugene HD transfection reagent (Promega) according to the manufacturer’s protocol and 48 hours later cells were selected for 3 weeks with 10 mM Nutlin-3 (Selleck Chemicals) ...
-
bioRxiv - Microbiology 2021Quote: ... Immunodetection was carried out using rabbit polyclonal anti-Halo antibody (Promega; 1:1000), mouse anti-HA antibody (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... 10 μL per well of MTS/PMS (20:1, Promega, Madison, WI, USA) solution was added to each well containing 100 μL of culture medium ...
-
bioRxiv - Systems Biology 2022Quote: ... Protein enzymatic cleavage was carried out with trypsin (Promega; 1:20, w/w) at 37 °C for 16 h ...
-
bioRxiv - Cell Biology 2022Quote: The AP-1 complexes were expressed in BL21 (DE3) pLysS (Promega, Madison, WI) strains and induced with 0.3 mM isopropyl-β-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µl DNA was then PCR-amplified with GoTaq® Green Mastermix (Promega) and locus-specific primers that anneal either within or outside of the excised genomic DNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Regenerating axons were then visualized by staining for βIII-tubulin (1:2000, Promega). Cell density was visualized using nuclear marker DAPI (0.2mg/ml ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg pHAGE-HA-FIP200-IRES-puro and mutants with FuGENE HD (Promega) for 18 hrs and then treated with 10 μM Oligomycin (Calbiochem) ...
-
bioRxiv - Microbiology 2020Quote: ... The supernatants were collected and incubated with 1 μM HaloTag TMR Ligand (Promega) at room temperature for 20 min ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2022Quote: ... and 10% glycerol) and a 1:50 dilution of Nano-Glo substrate (Promega). This mixture was placed in a 384 well plate and luminescence was measured in a Spark Plate Reader (Tecan).
-
bioRxiv - Molecular Biology 2022Quote: ... proteins from HL-1 cells were extracted with Passive Lysis Buffer (Promega France). Bioluminescence was quantified with a luminometer (Centro LB960 ...
-
bioRxiv - Plant Biology 2022Quote: ... DNase was inactivated by adding 1 μl of RQ1 DNase stop buffer (Promega). The DNase-treated RNAs were subsequently reverse transcribed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein enzymatic cleavage was carried out with trypsin (Promega; 1:50, w/w) at 37 °C for 16 h ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was digested with RQ1 RNase-free DNase (Promega) and then reverse transcribed using anchored oligo dT primers and Superscript II (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were digested overnight by adding 1 μg of trypsin (Promega, Madison, Wisconsin) in 100 μL ABC at 37 °C overnight ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 150 nM of LactC2-eGFP and 0.07 U μL−1 RQ1 DNase (Promega). Liposomes were then transferred to the tube with deposited dried precursor films ...
-
bioRxiv - Genetics 2020Quote: ... 1 uM of each primer and 1X of reaction buffer (Promega, Madison WI). Thermal cycles were set up to an initial denaturing step of 95 C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 25 pmol of each primer and 1 U of GoTaq DNA polymerase (Promega). Reactions were run by an initial denaturalization (5 min ...
-
bioRxiv - Systems Biology 2021Quote: ... Proteins were digested overnight by adding 1 μg of trypsin (Promega, Madison, Wisconsin) in 100 μL ABC at 37 °C overnight ...
-
bioRxiv - Neuroscience 2020Quote: ... The membranes were probed with horseradish peroxidase-conjugated secondary IgG (1:7000, Promega) for 1 hr at room temperature ...
-
bioRxiv - Developmental Biology 2020Quote: ... The primary antibodies that were used are mouse β-Gal (1:250; Promega), mouse anti-Cora C615.16 (1:400 ...
-
bioRxiv - Cancer Biology 2021Quote: ... then digested overnight at 37 °C with 1 μg Lys-C (Promega, VA1170) and dried in vacuo ...
-
bioRxiv - Plant Biology 2020Quote: ... 100µg protein were digested in solution with RapiGestTM with 1 µg Trypsin (Promega) over night ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Cells were resuspended in Nano-Glo dilution buffer and fumarazine (1:20) (Promega) and seeded in 96-well half area white plates ...
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Developmental Biology 2021Quote: The antibodies used were: Rabbit anti-pJNK pTPpY (1:500, Promega, Cat#V93B), Rat anti-Ci(1:1,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... the GST tag was cleaved from GST-TES-1 using ProTEV Plus (Promega), according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: Tig-1 cells were stably transfected using FuGENE® HD Transfection Reagent (Promega), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... and RFP (to 1 μg) using FuGENE HD according to manufacturer’s instructions (Promega). 24 h later supernatants were analysed for LDH activity using the Pierce LDH Cytotoxicity Assay Kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1 μg was used in a reverse transcription reaction with Random Primers (Promega) and RevertAid Reverse Transcriptase (ref ...
-
bioRxiv - Genomics 2022Quote: ... Raw values (Table 1) were measured on the GloMax-Multi Detection System (Promega).
-
bioRxiv - Genomics 2022Quote: ... diluted to 1% in purified human genomic DNA (Promega, female, catalog No. G1521). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease inhibitor (1 uL/ml; Promega, Madison, WI; Cat#N2511). These washes were followed by an additional wash with 500 μl each of both wash buffer and high salt wash buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease inhibitor (1 ul/ml; Promega, Madison, WI; Cat#N2511) with a mechanical homogenizer followed by addition of TURBO DNase (2 μl ...
-
bioRxiv - Microbiology 2023Quote: ... 1×106 Sf9 insect cells were transfected with bacmid DNA using Fugene (Promega) and cultivated for three days ...
-
bioRxiv - Microbiology 2023Quote: ... The size of the band was confirmed using a 1 Kb ladder (Promega). Sequencing was performed bidirectionally using the respective forward and reverse primers at Macrogen (Korea).
-
bioRxiv - Microbiology 2022Quote: ... A 1:100 dilution was made of the Nano-Glo Luciferase Assay (Promega) working solution ...
-
bioRxiv - Molecular Biology 2022Quote: Isolated total RNA (1 μg) was treated with RQ1 RNase-Free DNase (Promega) to remove genomic DNA and then reverse transcribed using a High-Capacity cDNA reverse-transcription kit with random hexamer primers (Applied Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... Secondary anti-mouse IgG HRP antibody was used at 1:7000 dilution (Promega). ChemiDoc (Bio-Rad ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were incubated with 1 nM Halo Tag TMR Ligand (G825A, Promega) at 37 °C for 2 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1 μg of total RNA was treated with RQ1 Rnase-free DNase (Promega) and reverse transcribed using SuperScript II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using 1 μL of unpurified template LET and 0.5 μL of FluoroTectTM (Promega) per 10 μL reaction ...
-
bioRxiv - Neuroscience 2024Quote: ... 50 mM triethylammonium bicarbonate and 1 μg of Trypsin/Lys-C mix (Promega) were added ...
-
bioRxiv - Cell Biology 2023Quote: ... Primary antibody against HaloTag® (G9211; 1:1000) was purchased from Promega (UK).
-
bioRxiv - Genomics 2024Quote: ... Membranes were then incubated with 1:10000 HRP-conjugated secondary antibody (Promega #W402B) in TBST + 5% milk for 1 hour at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 1 µg of the specific lentiviral plasmid/construct using FugeneHD (Promega, E2311) in Optimem (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-mouse IgG (H+L) HRP-conjugated (1:10000; Cat. no. W4021, Promega), and anti-rat IgG (H+L ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-rabbit IgG (H+L) HRP-conjugated (1:10000; Cat. no. W4011, Promega), anti-mouse IgG (H+L ...