Labshake search
Citations for Promega :
351 - 400 of 7092 citations for Rat Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The PCRs were performed in a final volume of 20 μl of amplification mix containing 1 U of GoTaq polymerase (Promega, Madison, WI), 1× GoTaq buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... the SCN cultures were maintained in a 35-mm petri dish with 1 mL culture medium containing 0.3 mM D-luciferin (Promega, Madison, WI, USA) at 36 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The captured proteins were washed twice in 200 μl of 95% MeCN and transferred to 200 μl of 50 mM ammonium bicarbonate (ABC) containing 1 μg sequencing grade modified trypsin (Promega, Madison, USA) and mixed for 2 hr at 37 °C ...
-
bioRxiv - Genetics 2023Quote: ... The first-strand cDNA from a colonic sensory neuron was used as template in a PCR reaction containing 1×GoTaq reaction buffer (Promega Madison, WI), 20 mM outer primers ...
-
bioRxiv - Molecular Biology 2019Quote: PERP protein-protein interactions were isolated using the HaloTag Mammalian Pull-Down System (Promega) and standard protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and the total protein contents were quantified using BCA Protein Assay Reagent (Promega Corporation). The supernatants were stored at –80 ℃ until subsequent analysis.
-
bioRxiv - Plant Biology 2024Quote: ... Proteins were expressed with TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega) and reactions were incubated for 12h at 25°C with 10µg pIX-HALO expression clone ...
-
bioRxiv - Bioengineering 2023Quote: The 36PillarPlate with HLOs was sandwiched with an opaque white 384-well plate containing 20 μL of CellTiter-Glo® Reagent from CellTiter-Glo® cell viability kit (Promega, Madison, WI, USA) and 20 μL of cell culture medium in each well to measure cellular adenosine triphosphate (ATP ...
-
bioRxiv - Genetics 2019Quote: ... Purified recombinant luciferase protein (Promega) was used to generate a standard curve.
-
bioRxiv - Genomics 2022Quote: ... and the LgBiT Protein (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Magne Protein G beads (Promega) were used to purify the antibodies according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... In vitro translated proteins (Promega SP6-TNT Quick rabbit reticulocyte lysate system ...
-
bioRxiv - Cancer Biology 2022Quote: ... A BCA protein assay (Promega) was used to determine protein concentration ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HiBiT control protein (#N301A, Promega) dilutions were prepared in the same medium and added (10 µl/well) ...
-
Pushed to the edge: hundreds of Myosin 10s pack into filopodia and could cause traffic jams on actinbioRxiv - Cell Biology 2023Quote: ... Halo Standard Protein (Promega, G4491) samples were prepared for final masses of 1 ng ...
-
bioRxiv - Biochemistry 2023Quote: ... with purified LgBiT Protein (Promega). Briefly ...
-
bioRxiv - Biophysics 2023Quote: ... Protein samples were trypsinized (Promega) in 40mM ammonium bicarbonate (FISHER SCIENTIFIC) ...
-
bioRxiv - Molecular Biology 2019Quote: The putative LINC00662 binding regions within the ELK4 gene were amplified by PCR and cloned into downstream of pmirGLO dual-luciferase vector (Promega, Madison, WI, USA) to form the wide-type plasmid (ELK4-3’UTR-Wt ...
-
bioRxiv - Biochemistry 2021Quote: ... or mutant type (MT) and KCNQ1OT1 binding sites were synthesized and replicated onto a pGL3 Dual□luciferase Target Vector (Promega, Madison, WI, USA), to create Wild Type and Mutant Type let-7a-5p plasmids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... 0.025% deoxycholate and 200 µg.mL−1 RNase A at 37°C for 20 min to lyse the cells and Protein Precipitation Solution (Promega) was added ...
-
bioRxiv - Cell Biology 2019Quote: ... the protein sample was digested by incubation with sequencing-grade modified trypsin (1/50, w/w; Promega, Madison, Wisconsin) overnight at 37°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Cell Biology 2021Quote: ... Alkylation was quenched by the addition of 3 mM DTT and proteins were digested overnight at 37°C with 1 μg trypsin (0.5 μg/μl; Promega). Following digestion ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:3 with 50 mM HEPES pH 8.5 and then digested by a 1:50 (trypsin to protein) ratio of sequencing grade modified trypsin (Promega) for 16 hours at 600 rpm and 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... urea was diluted to 1 M and proteins digested overnight with modified sequencing grade trypsin (Promega, Madison, WI, USA) at a 1:50 enzyme:protein ratio ...
-
bioRxiv - Microbiology 2021Quote: ... PA) and AccuMap™ low pH protein digestion kit (with trypsin and lysC) and chymotrypsin (sequencing grade) were from Promega (Madison, WI). PreScisson protease was from GenScript (Piscataway ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were either treated with 50ng/ml rat Nerve Growth Factor (NG; Promega, Madison, WI, USA) at 0 ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples (about 20 μg of protein) were digested with 500 ng of trypsin (Promega) and peptides were analysed by an Ekspert nanoLC 42 nanoflow system (Eksigent Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... was performed to measure the specific killing activity of anti-HIV CAR-T cells toward LHL2/3 cells and LEL6 cells at different ratios from 1:1 to 10:1 by using the CytoTox 96 non-radioactive cytotoxicity kit (Promega, Madison, WI, United States) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... cells was transfected with 250ng of each of 2 pX330 constructs (containing Cas9 and 1 sgRNA) and 500 ng of the plasmid template with FuGene HD transfection reagent (Promega Corporation, Madison, WI) in the recommended conditions ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2021Quote: ... the culture medium was removed and treated with caspase-1 assay kit (Promega) following the manufacturer’s instructions.
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 0.3 % Tween) containing 0.5 μg/μl Proteinase K (Promega) at 55 °C for 1-2 hours ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and serial dilutions of indicated human mAbs ...
-
bioRxiv - Cancer Biology 2021Quote: ... in DMEM containing 10% FBS using FuGene HD (Promega). Scale up the number of 293FT cells and transfection depending on the yield and library size ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Microbiology 2023Quote: ... containing 5 x 104 Jurkat effector cells (Promega # G701A) and 10 μl of pooled mouse sera from naïve or immunized mice with HCoV-OC43 N-His ...
-
bioRxiv - Molecular Biology 2023Quote: ... and one containing empty vector ((V0) psiCHECK2 (Promega, C8021)) were designed ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 50mM NH4HCO3 solution containing trypsin (sequencing grade, Promega) at a 1:20 protease:protein ratio (w:w) ...
-
bioRxiv - Cell Biology 2024Quote: ... a solution containing 50 nM JF549-HTL (Promega GA1110) was applied for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by permeabilization with wash buffer containing Digitonin (Promega). Samples were incubated with rabbit IgG (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: The kinase activity of the FLT3-ITD protein was measured by using ADP-Glo™ Kinase Assay Kit (Promega, Madison, Wisconsin, the US). Briefly ...
-
bioRxiv - Microbiology 2019Quote: ... SDC concentration was adjusted to 1% and 120 µg of proteins from each bacterial culture were digested by addition of trypsin (Promega) in a 1:50 (enzyme:protein ...
-
bioRxiv - Microbiology 2019Quote: Protein digestion - for samples processed with reagent 1 and 2 as well as for supernatants (proteomes) MS grade trypsin (Promega) was used at 1:1000 w/w protease:protein ...
-
bioRxiv - Bioengineering 2020Quote: ... In-solution protein digestion was carried out in a ratio of 1:25 w/w Trypsin/Lys-C (Mass Spectrometry Grade, Promega) to protein overnight at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns with cellular extracts were carried out as described for GFP-immunoprecipitations using 1-2 μg of GST-fused proteins bound to glutathione magnetic beads (Promega). For immunoprecipitations of recombinant proteins ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Cell Biology 2022Quote: ... The trapped proteins were washed four times with the methanol TEAB buffer and then digested using 1 µg Trypsin (Promega) overnight at 37°C ...