Labshake search
Citations for Promega :
601 - 650 of 7092 citations for Rat Starch Binding Domain Containing Protein 1 STBD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... The proteins were digested overnight with trypsin (Promega) at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were diluted in 50 mM ammonium bicarbonate and normalized to 50 μg protein for overnight LysC/trypsin digestion (Promega, protein:enzyme ratio, 50:1). Trifluoroacetic acid (TFA ...
-
bioRxiv - Cell Biology 2023Quote: ... pH 8.5 to a final urea concentration of 2 M for Trypsin/Lys-C based overnight protein digestion at 37 °C (40 µg of protein used for global proteomics and the remainder for phosphoproteomics, 1:70 protease: substrate ratio, Mass Spectrometry grade, Promega Corporation, Cat No: V5072.) Digestions were acidified with trifluoroacetic acid (TFA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were transfected with transfection mix containing 50 μL FuGENE HD (Promega) and 1000 μL Opti-MEM (Thermofisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 μL 40mM ABC containing 0.5 μL of trypsin gold (Promega, V528A) in PBS was added to each sample and samples were incubated overnight at 37°C in a closed ...
-
bioRxiv - Bioengineering 2019Quote: ... permeabilized with tris-buffered saline (TBS) containing 0.5% Triton X-100 (Promega), and blocked with AbDil (2 wt % bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2019Quote: ... containing 500 μl of nuclease free water (Cat. N°. P119C/Promega/U.S.A). The upper part of the swabs was cut using sterile scissors to allow closing of the tube ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 100 nM bafilomycin A1 and 37.5 nM TMRDirect Halo Ligand (Promega). After 2 hours in EBSS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The pGL3-basic plasmid containing a reporter gene was purchased from Promega Co ...
-
bioRxiv - Physiology 2021Quote: ... pH 8) containing a cocktail of protease inhibitors (Promega Corporation, Madison, WI) using a Precellys24 and 2 mm zirconium oxide beads (2 x 25 s at 6800 rpm ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5% Sodium deoxycholate and 0.1% SDS) containing protease inhibitors (Promega, Madison, USA) and centrifuged at 10,000× g (30 min at 4°C) ...
-
bioRxiv - Microbiology 2020Quote: ... containing 13.5 μL of GoTaq Green Master Mix (Promega, Cat No.: M7123), 1.5 μL of Human GAPDH Forward Primer (5’– AGAAGGCTGGGGCTCATTTG–3’) ...
-
bioRxiv - Molecular Biology 2020Quote: ... this was assessed using a luciferase positive control pGL3 containing SV40 (Promega) and trypan blue staining ...
-
bioRxiv - Molecular Biology 2021Quote: ... 80 µl of PNK buffer containing 4U Thermosensitive Alkaline Phosphatase (TSAP) (Promega) and 2µl RNasin® (Promega ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μl 5X colorless GoTaq reaction buffer (containing 7.5 mM MgCl2) (Promega), 6.225 μl deionized water ...
-
bioRxiv - Microbiology 2021Quote: ... dNTP nucleotide mix containing 200 µM concentrations of each nucleotide (Promega, USA), and 1.25U of GoTaq DNA polymerase (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... and pGL4.74 containing the Renilla luciferase reporter gene (0.5 μg/dish, Promega), as an internal control ...
-
bioRxiv - Immunology 2020Quote: ... Washed beads were resuspended in 50mM ammonium bicarbonate containing 25ng trypsin (Promega) by brief bath sonication and incubated at 37°C O/N ...
-
bioRxiv - Immunology 2020Quote: ... followed by a medium change to supplemented DMEM containing 1µM luciferin (Promega). Data were further processed and analyzed using Chronostar 3.0 [49].
-
bioRxiv - Biophysics 2022Quote: ... and PiggyBac transposon plasmid containing puromycin selection using FuGENE (Promega, Madison, WI) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... containing flanking sequences that matched the pNL3.2NF-κB-RE plasmid (N111A, Promega). The pNL3.2NF-κB-RE plasmid was PCR amplified with primers containing sequences flanking the 5’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by 25 μL of the HBSS containing GloSensor cAMP Reagent (Promega). Plates were kept in a dark place at room temperature for two hours to equilibrate cells with the reagent ...
-
bioRxiv - Cell Biology 2023Quote: ... neurons were incubated in media containing 50nM JF646 HaloTag ligand97 (Promega GA1120) or JFX554 HaloTag ligand98 (Kind gift of L ...
-
bioRxiv - Microbiology 2024Quote: ... which included a 5 µl nucleotide mix containing 2.5 mM NTPs (Promega). For each reaction ...
-
bioRxiv - Plant Biology 2021Quote: ... The pSPUTK promoter allowed in vitro protein synthesis using the TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cell supernatants were analyzed by hemagglutination assay with rat erythrocytes26 and by Renilla luciferase assay (Dual-Luciferase® Reporter Assay System, Promega). Titers were calculated by the Spearman-Kaerber formula ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Bacterial DNA was extracted from 1 ml of culture using the Wizard genomic DNA purification kit (Promega). Evolved population DNAs were sequenced at the GeT-PlaGe core facility (https://get.genotoul.fr/) ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA synthesis was performed on 1 µg of RNA using ProtoScript First Strand cDNA Synthesis Kit (Promega). Primers recognizing exons flanking the CRISPR-targeted exon (Supp ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mL of culture was used for genomic DNA isolation with the Wizard DNA Purification Kit (Promega). Approximately 2 µg of DNA was used to prepare a paired-end 250-bp sequencing library with the Nextera XT DNA library kit ...
-
bioRxiv - Biophysics 2022Quote: ... PCR products were separated on 1% agarose gel and purified using a Gel extraction kit (Promega, CA). Sequences of forward and reverse primers are listed in Supplementary Table S21 ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 µg of total RNA was used to synthesize cDNA using M-MLV reverse transcriptase kit (Promega) using the supplier’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each sample was then diluted 10-fold with 50 mM ammonium bicarbonate for digestion with 0.375 µg (for 15 µg protein samples) or 0.125 µg (for 5 µg protein samples) sequencing grade modified porcine trypsin (Promega, Madison, WI, USA). The samples were incubated at 45°C for 1 hour in a chilled microwave (CEM ...
-
bioRxiv - Cancer Biology 2021Quote: ... The proteins were digested with trypsin (Promega Corporation, USA) at an enzyme-to-substrate ratio of 1:50 (w/w ...
-
bioRxiv - Molecular Biology 2021Quote: ... 30 μg of protein were digested with trypsin (Promega) in two steps (2 h at 37 ºC with 1:40 trypsin:protein ratio ...
-
bioRxiv - Biochemistry 2020Quote: ... The protein was then digested with Trypsin Gold (Promega) 1:100 at 37 °C overnight in 10 mM ammonium bicarbonate pH 8.0 and the resultant peptides were cleaned up with POROS 20 R2 (Applied Biosystens) ...
-
bioRxiv - Immunology 2019Quote: ... Protein material was digested with 600 ng Trypsin (Promega) overnight at 37°C at 300 rpm ...
-
bioRxiv - Developmental Biology 2019Quote: ... Precipitated proteins were subjected to on-bead trypsin (Promega) digestion ...
-
bioRxiv - Bioengineering 2021Quote: ... Proteins were digested with sequencing grade modified trypsin (Promega) at an enzyme to substrate ratio of 1:50 overnight at RT ...
-
bioRxiv - Bioengineering 2020Quote: ... Proteins were digested with sequencing grade modified trypsin (Promega) at an enzyme to substrate ratio of 1:50 overnight at RT ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of the Halo 7-tag protein (Promega), with the insertion of a 63-base linker (21 amino acids ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were digested overnight with LysC/Trypsin mix (Promega) and sequencing-grade modified Trypsin (Promega ...
-
bioRxiv - Neuroscience 2019Quote: ... Protein was digested with sequencing grade modified trypsin (Promega) using the FASP (Filter Aided Sample Preparation ...
-
bioRxiv - Microbiology 2019Quote: ... proteins were predigested with 1.5 µg of rLysC (Promega) for 3 h at room temperature and samples diluted with 50 mM ammonium bicarbonate ...
-
bioRxiv - Molecular Biology 2021Quote: ... with Broad Range Protein Molecular Weight Markers (V8491, Promega) used as molecular markers ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were harvested in passive lysis buffer 1x (Promega) at indicated times and
-
bioRxiv - Plant Biology 2021Quote: Eluted proteins were digested with sequencing-grade trypsin (Promega) and analyzed by nano LCMS/MS on a QExactive + mass spectrometer coupled to an EASY-nanoLC-1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were digested with trypsin (Promega, Madison, Wisconsin, USA) in 40 mM AmBic at 37°C for 18 h (enzyme to protein ratio (v/w ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were digested first by Lys- C (Promega, USA) at RT for 2 hours ...