Labshake search
Citations for Promega :
351 - 400 of 1017 citations for IL 2 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Developmental Biology 2024Quote: ... Total peptide concentration was adjusted to 0.15 µg/µL according to the absorbance at 280 nm against a Mass Spec-Compatible Human Protein Extract/Digest calibration curve (Promega), using the Thermo Nanodrop 1000 ND-1000 spectrophotometer (Thermo Fisher).
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of expressing plasmids were transfected using Fugene HD (Promega, #E2311). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse-transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and were incubated with Glosensor reagent (Promega, 7.5 μL, 2% final concentration) for 90 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All hADAR1/2 fragments were cloned into the pCI-Neo vector (Promega) to generate the pCI-ADAR vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the samples were digested overnight with 2 μg sequencing grade trypsin (Promega) and trypsin inactivated by adding TFA to a final concentration of 1% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: 50 nl of reverse transcription mix (2 mM (each) dNTP mix (Promega) and 0.8 Units Superscript III (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... On odd days 30 μl of Cell TiterGlo 2 (Promega cat # G924A) was added to the remaining 40 μl culture and incubated 10 min ...
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mL of Halo Magne bead slurry (cat. #G7287, Promega, Madison, WI) were washed with MilliQ water and 3 CV of modified CSF-XB ...
-
bioRxiv - Biochemistry 2021Quote: ... the samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C ...
-
bioRxiv - Genetics 2019Quote: ... 1 mM CaCl2 with 2 ug trypsin (Promega, Madison, WI, product V5111). Digest was stopped with formic acid ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The Nano-Glo Luciferase Assay Substrate furimazine (2 µl ml-1, Promega) was added and the luminescence was measured on a luminometer (Mithras LB 940 Berthold Technologies plate reader ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μl 5X colorless GoTaq reaction buffer (containing 7.5 mM MgCl2) (Promega), 6.225 μl deionized water ...
-
bioRxiv - Genomics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). PCR products were separated following agarose gel electrophoresis ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated with 2% of the GloSensor reagent (Promega, cat. # E1290). Relative luminescence units were recorded using a SynergyMx microplate reader (Biotek) ...
-
bioRxiv - Genetics 2020Quote: ... cells were transfected with 50 ng/well of the psiCHECK-2 (Promega) construct using the FuGENE HD Transfection Reagent (Promega) ...
-
bioRxiv - Genetics 2019Quote: ... and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). The PCR amplicons were applied onto a 2% agarose gel with appropriate controls and markers.
-
bioRxiv - Microbiology 2022Quote: ... On-bead digestion was performed using sequencing-grade trypsin (2 μg; Promega) in 2 M urea in 100 mM triethylammonium bicarbonate (TEAB ...
-
bioRxiv - Systems Biology 2022Quote: ... Samples were shortly cooled to room temperature and 2 µl LysC (Promega) added pre-diluted in ultra-pure water to 2 ng/µl and digested for 4 h at 37°C in the thermal cycler ...
-
bioRxiv - Neuroscience 2023Quote: ... before introduction of 2 μl seeds (diluted 1:5) using MultiFectam (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 units of calf intestinal alkaline phosphatase (Promega; M182A) at 37°C for 10 min at 1000 rpm in a Thermomixer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dual Luciferase assay kit and PsiCHECKTM-2 vector were purchased from Promega. Oligonucleotides were synthesized and obtained from Eurofins Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were digested with 2 μg of trypsin (Promega, Madison, WI, USA) at 47°C for 2 h ...
-
bioRxiv - Biochemistry 2023Quote: ... Bovine alpha-2-hs-glycoprotein was isolated from plasma (Fetuin, Promega, V4961), and monocyte differentiation antigen CD14 was recombinantly expressed in CHO cells (R&D systems ...
-
bioRxiv - Bioengineering 2023Quote: ... and digested for 2 hours at 50°C using Trypsin Platinum (Promega) using 1:50 Trypsin to sample ratio by mass ...
-
Comparative membrane proteomics reveals diverse cell regulators concentrated at the nuclear envelopebioRxiv - Cell Biology 2023Quote: ... supplemented with 1 mM CaCl2 and digested with 2 μg trypsin (Promega) for 15 h at 37ᵒC ...
-
bioRxiv - Biochemistry 2023Quote: ... and incubated in 2 nM JF549-Halo-ligand (Cat. No. GA1110; Promega) for 15 minutes at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... and program DLR-2-INJ on a Glomax 20/20 Luminometer (Promega) with 20μl cell extract as the input.
-
bioRxiv - Biochemistry 2024Quote: ... alkylated with 2-iodoacetamide and digested with Endopeptidase Trypsin (sequencing grade, Promega) overnight ...
-
bioRxiv - Biochemistry 2023Quote: ... and proteolysis was performed by adding either 2 μg of trypsin (Promega) or a combination of 2 μg of trypsin and 0.2 μg of LysC (Promega) ...