Labshake search
Citations for Promega :
301 - 350 of 1017 citations for IL 2 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µl/well of FuGENE 6 Transfection reagent (Promega; E2691) following the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µl/well of FuGENE 6 Transfection reagent (Promega; E2691) following the manufacture’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... or pB.2-eIF2α-S51A plasmids by use of FuGENE6 (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Each reaction was treated with 2 units of RQ1 DNase (Promega) for 30 min at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μl of Trypsin/Lys-C mix (0.5μg/μl, Promega, V5073) was added to each sample and incubated for 3 hrs at RT in the dark ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C after adding 50 mM ammonium hydrogen carbonate to a final concentration of 1 M urea ...
-
bioRxiv - Plant Biology 2020Quote: ... from 2 μg RNA treated with RQ1 RNase-free DNase (Promega). The cDNA was then diluted 20 times in water and 5 μl of the dilution was used for the realtime qPCR analysis ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were additionally diluted 2-fold and digested with trypsin (Promega, Sequencing Grade Modified Trypsin ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg Lys-C/Trypsin mix protease (Promega, Mass spec grade) were added to each sample (10 mM EPPS pH 8.5 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The RdRP products were treated with RNase I (2 U, Promega) at 37°C for 2 hours to digest single-stranded RNAs completely ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 2× GoTaq q-PCR master mix (Promega, USA) and 0.6 μM of AF77/78 or AF79/80 primer pairs targeting a region close to the Cori or to the terminus (ter) ...
-
bioRxiv - Genetics 2020Quote: ... 2 μg RNA were treated with RQ1 RNase-free DNase (Promega) followed by reverse transcription using M-MLV Reverse Transcriptase (Promega ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 μg of MS grade Trypsin Platinum (Promega, Madison, WI, USA) in 40 μL of digestion buffer containing 50 mM TEAB was added into the filter and digested at 37°C for 16 h ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nano-Glo Luciferase Assay Substrate furimazine (2 µl ml-1, Promega) was added and the nLuc released upon proteolytic cleavage of the receptor was measured on a plate reader Mithras LB 940 (Berthold Technologies ...
-
bioRxiv - Physiology 2023Quote: ... The assay medium was supplemented with 2% GloSensor Reagent (Promega #E1291) and 0.1% BSA ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μM 11S and 2 μl furimazine solution (Promega Cat. # N1610) were added and the luminescence read at 1 min intervals for 10 min using the FLUOstar Omega using a gain value of 3,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids (2 μg /dish) were transfected using FuGENE6 transfection reagent (Promega), according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2023Quote: ... Any remaining RNA was removed with 2 µl RNase A (Promega) added to a pool of DNA samples ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 2 μL/well of One-Glo detection reagent (Promega, cat # E6120) was added to all microplate wells via Multidrop ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 µl of RNAse A solution (4 mg ml-1) (Promega) were added before incubation at 37°C for 15 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... the GoTaq 2-step RT-qPCR system (Promega, Madison, MA, USA) was utilized to perform cDNA synthesis and qPCR ...
-
bioRxiv - Physiology 2024Quote: The 2-DG glucose uptake for tissues was analyzed by Promega Glucose uptake-Glo assay method (#J1341) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Crosslinks were reversed by addition of 2 uL Proteinase K (Promega) and incubation at 65 °C for 12-16 hours in a Thermomixer ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10X Primer extension buffer and 2 U AMV Reverse Transcriptase (Promega) were added to the annealing mixture and incubated for 1 hour at 42 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 ng of Renilla luciferase expressing pRL SV40 plasmid (E2231, Promega), as internal control ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Biochemistry 2021Quote: ... yeast (Saccharomyces cerevisiae) cell protein extract (Cat# V7341, V7461), and human K562 cell protein extract (Cat# V6951, V6941) were purchased from Promega Inc (WI ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...