Labshake search
Citations for Promega :
351 - 400 of 5245 citations for 7 chloro 3' 4 6 trimethoxy 5' methylspiro 1 benzofuran 2 6' cyclohex 2 ene 1' 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... using Fugene 6 (Promega).
-
bioRxiv - Microbiology 2020Quote: ... using FuGENE 6 (Promega). Sixteen hours later ...
-
bioRxiv - Cell Biology 2022Quote: ... or FuGENE 6 (Promega) following the manufacturer’s protocol with modifications (see below).
-
bioRxiv - Microbiology 2022Quote: ... or Fugene 6 (Promega) and supernatants harvested 3 days later ...
-
bioRxiv - Cell Biology 2023Quote: ... utilizing Fugene 6 (Promega). Culture supernatants were collected at 48h and 72h post-transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... and FuGENE 6 (Promega), at a 2:1 FuGENE:DNA ratio ...
-
bioRxiv - Cell Biology 2024Quote: ... using Fugene 6 (Promega) at a ratio of 3 µL per 1 µg DNA ...
-
bioRxiv - Microbiology 2019Quote: ... For transfection 0.5 or 2 µg of plasmid DNA in 25 or 200 µL serum-free medium were mixed with 1 or 4 µL of FuGENE HD transfection reagent (DNA to reagent ratio of 1:2, Promega, Mannheim, Germany) and incubated for 10 min at RT ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... t-ERK1/2 (Promega V114A, 1/1000 dilution), p-AKT (Cell Signaling Technology ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg trypsin (protein:enzyme ratio 50:1; Promega) were added and proteins were digested at 37 °C for 18 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:2 DNA:FuGENE® HD transfection reagent (Promega) ratio and 2 μg of specific plasmid ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 or 4 (Promega Madison, WI, USA) (62) ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were simultaneously transfected with 1 μg pCS2Cachd1-eGFP or pCS2Cachd1_V1122D-eGFP and 1 μg KDEL-tRFP plasmid using Fugene 6 transfection reagent (Promega). eGFP/tRFP expression was confirmed 24 hours post transfection and the cells fixed at 42 hours post transfection and imaged on a spinning disk microscope (see below).
-
bioRxiv - Cell Biology 2020Quote: ... The caspase-3/7 activity of the lysates or the plated cells was analysed using Apo-ONE ® Homogenous Caspase-3/7 Assay (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmid DNA (6 μg) was delivered into U2OS cells using FuGENE 6 (Promega) and 2.5 μg of plasmid DNA was delivered into HeLa cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Caspase activity was determined using Caspase-Glo® 3/7 Assay Systems (Promega, Madison, WI) according to the manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Promega Caspase-Glo® 3/7 Assay Systems (Promega, Madison, WI, Cat No. G8091) was used to quantify apoptotic cell death
-
bioRxiv - Microbiology 2021Quote: ... caspase activity was measured using Caspase-Glo 3/7 Assay according to manufacturer’s instructions (Promega). Staurosporine (1μM ...
-
bioRxiv - Neuroscience 2020Quote: Caspase activity was measured using a chemiluminescent assay kit (Promega Caspase-Glo® 3/7) in 96-well format using an Analyst HT plate reader (Molecular Devices ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated for 24 hr before adding 40 μl of Caspase-Glo 3/7 (Promega) to each well ...
-
bioRxiv - Cancer Biology 2021Quote: ... The remaining cells in the inserts were analyzed with Caspase-Glo 3/7 assay (Promega) to confirm that Jurkat cells incubated with TAM CM did not induce apoptosis compared to the control medium.
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activation was measured using the CaspaseGlo 3/7 Assay Kit (Promega, Madison, WI, USA) according to manufacturer’s instructions for the indicated time point presented in the figure legend ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptosis was assessed by commercially available caspase 3/7 assay (Cat # G8090, Promega, Madison, WI) as per the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Microbiology 2021Quote: ... and an empty vector up to 1 μg of total DNA using FuGENE 6 (Promega). Sixteen hours later ...
-
bioRxiv - Molecular Biology 2021Quote: ... transfected with 1 µg DNA and 3 µl FuGENE HD (Promega, E2311) in 150 µl Opti-MEM media according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-activated Caspase 3 (rabbit, Promega, catalog #G7481, 1:250, RRID:AB_430875), and appropriate secondary antibodies ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by 3 μL sequencing-grade trypsin solution (1 μg/μL, Promega), and the sample was incubated for 12 h at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 μL of 1:100 diluted NanoBRET Nano-Glo substrate (Promega N1571) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 μL of BrightGlo reagent solution (Promega, diluted 1:3 in water) was added to each well after 24 h of compound treatment ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: The pGL-AP-1 plasmid containing 6 consensus AP-1 binding sites was co-transfected with the pRL-CMV plasmid (Promega) into cells using TransIT 2020 transfection reagent (Mirus Bio ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were diluted with 225 μL of 57.6 mM NH4HCO3 containing 1 mM TCEP and the mixtures treated with 1 μg of sequencing grade modified trypsin (Promega), incubated at 37 °C overnight and then acidified by addition of formic acid to 0.1 % v/v and stored at −20 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Neuroscience 2024Quote: Ensembl predicted regulatory region including the POU domain binding site on Aspm promoter/enhance (sequence from 5’-GAAAAAGTGGGCAGTAACTCGC-3’ to 5’-CAACCTTTCCCTGAGGACGATC-3’) was synthesized by Twist Bioscience and cloned into pGL3-Basic Luciferase Reporter vector (Promega) using the Gibson assembly method ...
-
bioRxiv - Genomics 2024Quote: ... and 1,750 ng landing pad G384A vector template using 6 μL Fugene 6 (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... 6 µg of plasmid DNA was then transfected using FuGENE 6 transfection reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... beads were suspended in digestion buffer (Tris 50 mM pH 7.5, urea 2 M, 1 mM DTT and 5 µg.µl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Physiology 2019Quote: ... 2 μL sequencing-grade trypsin (1 μg/μL; Promega) was added for the digestion at 37°C for 12 h ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μl of 1% Digitonin in DMSO (Promega (2%), Cat ...
-
bioRxiv - Molecular Biology 2020Quote: ... (49) as a negative control (2 μg of DNA per well of 6 well plate) with FuGene transfection reagent (Promega, Madison, WI) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated for an additional 2 – 6 days and cell growth was quantified using CellTiter-Glo® 2.0 Reagent (Promega, Cat. #924C). For immunoblot analysis ...
-
bioRxiv - Physiology 2023Quote: ... UMR106 cells were plated at 4 × 105 per well in a 6-well plate and transfected with 2 µg of NFAT5 gRNAs per well using the FuGENE® HD Transfection Reagent (Promega, USA). 24 h post-transfection ...