Labshake search
Citations for Promega :
301 - 350 of 4940 citations for 7 chloro 3' 4 6 trimethoxy 5' methylspiro 1 benzofuran 2 6' cyclohex 2 ene 1' 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... and caspase-3/7 activity were measured using the ApoTox-Glo Triplex Assay (Promega) in a GloMax-Multi+ Reader (Promega) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Apoptotic activity was determined by the Caspase-Glo 3/7 luminescent assay (Promega, G8092), Annexin-V staining (Roche ...
-
bioRxiv - Bioengineering 2020Quote: ... Cell apoptosis was measured using a Caspase-Glo 3/7 assay (Promega, Madison, WI).
-
bioRxiv - Cancer Biology 2023Quote: ... survival was assessed using Cell Titer-Glo and Caspase 3/7 Glo assays (Promega) and analyzed at 24–48h post-treatments ...
-
bioRxiv - Cell Biology 2023Quote: Caspase activity was assessed using Caspase-3/-7 Glo Luminescent Assay (Promega, Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Apoptosis was assessed using the luminescence-base Caspase-Glo 3/7 assay kit (Promega) and defined by at least a 1.5-fold increase in signal activation concerning controls ...
-
bioRxiv - Neuroscience 2023Quote: ... the Caspase-Glo® 3/7 assay was performed according to manufacturer’s instructions (Promega) on HEK cells after 40 h treatment with cisplatin ...
-
bioRxiv - Immunology 2023Quote: ... and an apoptosis assay using Caspase-Glo® 3/7 reagent (G8091, Promega, Canada), as per manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: A 3:1 ratio of FuGENE® HD Transfection Reagent (Promega) (μL ...
-
bioRxiv - Immunology 2021Quote: ... then each well was diluted 1:3 with TE buffer (Promega). A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... using random primers and oligo-dT primers (3:1 mol) (Promega). The obtained cDNA was stored at −20 °C until further use.
-
bioRxiv - Cell Biology 2019Quote: Glucose uptake was measured based on the detection of 2-deoxyglucose-6-phosphate uptake by a commercially available luminescence-based kit (Glucose Uptake-GloTM Assay, Promega) on a SpectraMax M3 (Molecular Devices) ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK293T cells were grown in two 175 cm2 flasks to ∼50% confluence and transfected with 25 μg plasmid and 75 μl FuGENE 6 in 2 ml Opti-MEM according to the manufacturers instructions (Promega). One day after transfection ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells and C3H10T1/2 cells were transfected in 6-well plates with various constructs of pmirGlo vector (Promega®). Transfection was performed using Turbofect transfection reagent (Thermo Fischer scientific® ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37 °C with 5% CO2 ...
-
bioRxiv - Cell Biology 2019Quote: Desired protein amounts were aliquoted and chloroform methanol precipitated, followed by digestion with LysC (overnight at room temperature, vortex speed 2; Wako) and trypsin (6 hours, 37° Promega) digestion ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were grown to 80% confluency before transfection with pCMV3-SARS-CoV-2-spike (kindly provided by Dr. Peihui Wang, Shandong University, China) using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 × 106 Sf9 cells in 2 mL of media in a 6-well dish were transfected with up to 2 µg of fresh bacmid DNA using FuGene HD transfection reagent (Promega) at a ratio of 3:1 (Fugene reagent:DNA ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Microbiology 2020Quote: ... HeLa cells were transfected 6 hours before imaging with Fugene 6 (Promega) and 1000ng of DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 μg of both plasmids was mixed with 6 μl FuGENE reagent (Promega E269A) in 200 μl serum free DMEM and incubated for 30 minutes before adding the transfection mix to the cells ...
-
bioRxiv - Cell Biology 2023Quote: ... 1 μg of both plasmids was mixed with 6 μl FuGENE reagent (Promega E269A) in 200 μl serum free DMEM and incubated for 30 min before adding the transfection mix to the cells ...
-
bioRxiv - Cell Biology 2020Quote: ... using Fugene 6 (Promega). Supernatant was harvested from the transfected cells for the next three days and then centrifuged ...
-
bioRxiv - Cell Biology 2020Quote: ... using Fugene 6 (Promega), with a linearized TCIS construct described previously6 ...
-
bioRxiv - Genetics 2021Quote: ... using FuGENE 6 (Promega) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using FuGENE 6 (Promega). Sixteen hours later ...
-
bioRxiv - Cancer Biology 2020Quote: Transfection: Fugene 6 (Promega); TransIT-2020 (Mirus Bio) ...
-
bioRxiv - Biophysics 2020Quote: ... FuGENE 6 (Promega, E2691) was used for transient transfection according to the manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: ... using FuGENE 6 (Promega) on day 0 ...
-
bioRxiv - Developmental Biology 2022Quote: ... or Fugene 6 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... using FuGENE 6 (Promega). Cells were cultured overnight at 37°C with 5% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... using Fugene 6 (Promega).
-
bioRxiv - Microbiology 2020Quote: ... using FuGENE 6 (Promega). Sixteen hours later ...
-
bioRxiv - Cell Biology 2022Quote: ... or FuGENE 6 (Promega) following the manufacturer’s protocol with modifications (see below).
-
bioRxiv - Microbiology 2022Quote: ... or Fugene 6 (Promega) and supernatants harvested 3 days later ...
-
bioRxiv - Cell Biology 2023Quote: ... utilizing Fugene 6 (Promega). Culture supernatants were collected at 48h and 72h post-transfection ...
-
bioRxiv - Microbiology 2019Quote: ... For transfection 0.5 or 2 µg of plasmid DNA in 25 or 200 µL serum-free medium were mixed with 1 or 4 µL of FuGENE HD transfection reagent (DNA to reagent ratio of 1:2, Promega, Mannheim, Germany) and incubated for 10 min at RT ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2022Quote: ... t-ERK1/2 (Promega V114A, 1/1000 dilution), p-AKT (Cell Signaling Technology ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg trypsin (protein:enzyme ratio 50:1; Promega) were added and proteins were digested at 37 °C for 18 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 or 4 (Promega Madison, WI, USA) (62) ...
-
bioRxiv - Developmental Biology 2022Quote: HEK293T cells were simultaneously transfected with 1 μg pCS2Cachd1-eGFP or pCS2Cachd1_V1122D-eGFP and 1 μg KDEL-tRFP plasmid using Fugene 6 transfection reagent (Promega). eGFP/tRFP expression was confirmed 24 hours post transfection and the cells fixed at 42 hours post transfection and imaged on a spinning disk microscope (see below).
-
bioRxiv - Cell Biology 2020Quote: ... The caspase-3/7 activity of the lysates or the plated cells was analysed using Apo-ONE ® Homogenous Caspase-3/7 Assay (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... Plasmid DNA (6 μg) was delivered into U2OS cells using FuGENE 6 (Promega) and 2.5 μg of plasmid DNA was delivered into HeLa cells using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Caspase activity was determined using Caspase-Glo® 3/7 Assay Systems (Promega, Madison, WI) according to the manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Promega Caspase-Glo® 3/7 Assay Systems (Promega, Madison, WI, Cat No. G8091) was used to quantify apoptotic cell death
-
bioRxiv - Microbiology 2021Quote: ... caspase activity was measured using Caspase-Glo 3/7 Assay according to manufacturer’s instructions (Promega). Staurosporine (1μM ...