Labshake search
Citations for Promega :
351 - 400 of 3534 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Immunology 2019Quote: ... BRET1 between hRLuc8 and mVenus was measured 5 min after addition of 5 µM coelenterazine H (Promega). BRET1 readings were collected using a Mithras LB940 reader (Berthold) ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells were pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells are pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 5’ UTR of mouse 5’-tRFCys targets or non-target Gapdh were cloned into psiCHECK2 (Promega). Synthetic 5’-tRF-Cys antisense or a scrambled control sequence embedded in the tough decoy backbone (Haraguchi et al. ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were cultured for two days at 37°C with 5% CO2 after which the supernatant was removed and replaced with 50 μl Nano-Glo Luciferase Substrate (Promega, Inc.). Light emission was measured in an Envision 2103 Multi-label plate reader (PerkinElmer ...
-
bioRxiv - Microbiology 2020Quote: ... Amplifications were performed in a 50 µl final volume using 5 µl of DNA template and 2.5 units of GoTaq polymerase (Promega, Madison, WI). Final concentrations of MgCl2 ...
-
bioRxiv - Systems Biology 2023Quote: The transfections were performed with a 1 mg DNA: 2 ml Fugene HD (Promega E2311) ratio ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Genomics 2022Quote: Cell viability upon siRNA transfection was measured through the CellTiter 96® Non-Radioactive Cell Proliferation Assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)) (Promega). 1× 104 microglia cells were plated per well in a 96 well plate and transfected with either ON-TARGETplus Non-targeting Control siRNA (Horizon Discovery) ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... In-gel digestion was performed by adding 25 μL of 4 μg/mL sequencing grade modified trypsin (Promega) in 25 mM ammonium bicarbonate ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Biochemistry 2020Quote: ... CellTiter-Glo 2 kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115) and 7 µL TGIRTIII enzyme (InGex) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL RNAse.In (Promega #N2115), 20 μL RNAse-free H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: The psiCHECK-2 plasmid (Promega) has a special NheI restriction site that was used to insert a synthetic DNA duplex encoding the G-rich region of the PRCC-TFE3 fusion gene in the upstream of the renilla luciferase initiation codon to create the plasmids G4Q27 and G4M27 (mutated G-rich region of the PRCC-TFE3 fusion gene) ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 2 mM DTT, 100 μg ml-1 cycloheximide [Sigma], 20 U ml-1 RNase inhibitor [Promega] ...
-
bioRxiv - Microbiology 2021Quote: ... Digested protein suspensions with 4 μg trypsin (Promega) in 40 μL 25 mM NH4HCO3 buffer at 37 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... 4 U RNasin Ribonuclease Inhibitor (Promega, Cat#N2115), 6 U Recombinant RNase Inhibitor (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 4 μL of RQ1 DNase (Promega, M6101) were applied to the lysate and incubated at 37 °C for 3 min ...
-
bioRxiv - Biochemistry 2019Quote: ... Protein was digested by incubation overnight at 37°C with trypsin (5 ng/ ml, Promega, Madison, WI) in 50 mM NH4HCO3 (pH 7.8) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were digested via the addition of 5 μL of sequencing grade trypsin (0.1 mg/mL) (Promega) for 3 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were subjected to digestion of Lys-C (Wako Chemicals) (1:50) for 2 h at RT and then to trypsin (Promega) (1:50 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 μg of each purified plasmid (pTnT-SEP3-3FLAG and pTnT- AGIAP1-5MyC) were used as input in a 50 μl TnT reaction incubated at 25 °C for 2 hr (Promega). The reaction solution was then combined with 50 μl IP buffer (PBS supplemented with 0.005 % NP40 and proteinase inhibitors (Roche) ...
-
bioRxiv - Systems Biology 2021Quote: ... Samples were resuspended in 100 µL of 50 mM ammonium bicarbonate and then subjected to proteolysis using either 2 µg of trypsin (Promega), 2 µg of AspN (Promega) ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 hours at 37° C and subsequently diluting to 1 M urea with 50 mM NH4HCO3 and finally adding 2% (w/w) trypsin (Promega) for 14 hours at 37° C ...
-
bioRxiv - Genomics 2020Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Microbiology 2023Quote: ... to a final urea concentration ˂ 2 M and then digested with modified trypsin (1:50 w/w) (Sequencing Grade, Promega) at 37°C for 3 h ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were starved by 50 μL Hank’s balanced salt solution for 30 min and then incubated in 50 μL CO2-independent media containing 2% GloSensor cAMP Reagent (Promega) for 1 hour ...
-
bioRxiv - Biochemistry 2023Quote: ... proteins were diluted with 50 mM NH4HCO3 to a final concentration of 2 M urea and digested with trypsin (Promega), at an enzyme-to-substrate ratio of 1:20 ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours followed by another overnight digestion with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Pathology 2024Quote: ... The samples were diluted with 50 mM TEAB buffer to a final Urea concentration of 2 M before adding trypsin (Promega) in an enzyme:substrate ratio of 1:75 and incubating at 25 °C for 16 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Zoology 2024Quote: ... The amplicon target was amplified from WNV cDNA using the qPCR primers with the forward primer flanked by T7 sequence (5’-TAATACGACTCACTATAGGGATTCGGGAGGAGACGTGGTA-3’) and transcribed using T7 RiboMAX Express Large Scale RNA Production System kit (Promega, France). RNA was purified by ethanol precipitation ...
-
bioRxiv - Microbiology 2020Quote: ... collected by centrifugation (17,000 g for 10 min at 4°C) and solubilized in 20 μl 50 mM TEAB containing 0.2 % ProteaseMAXTM Surfactant (Promega UK Ltd, Cat. # V2071) for 1-2 h with vortex and occasional sonication ...
-
bioRxiv - Molecular Biology 2021Quote: ... The protein pellet was resuspended in 190 ul of 50 mM ammonium bicarbonate and digested with 20 ul of 1 ug/ul trypsin gold (Promega V5280) at 37°C for 4 hours.
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 ng of pRL-SV40 (Promega) Renilla luciferase construct was added to the 384-well reporter library plates and incubated for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... NanoBRET Tracer 5 (Promega, Madison, WI, USA) was used at a final concentration of 1.0 μM as previously evaluated in a titration experiment ...
-
bioRxiv - Molecular Biology 2021Quote: ... and HaloTag TMR Ligand (5 mM) (Promega) were dissolved in DMSO (Sigma-Aldrich ...