Labshake search
Citations for Promega :
451 - 500 of 3534 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb 13C12 99% 50 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... We identified a common tracer probe (K-4, Promega), suitable for all mutants ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 4 µL FuGene HD (Promega), 1 µg sgRNA-Cas9 plasmid DNA ...
-
bioRxiv - Biophysics 2022Quote: ... 4% glycerol with 12 units RNasin (Promega, Madison, WI), 10 μg/ml BSA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of random primers (Promega) were added after which the mixture was incubated at 65 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μg of Trypsin (Promega, V5111) was added to each sample and they were incubated shaking at 37°C overnight (o/n) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25 µl of 2% digitonin (Promega) and 0.5 µl of 10% Tween-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U GoTaq Flexi Polymerase (Promega) and 0.22 µg TaqStart Antibody (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μL Superasin RNase inhibitor (Promega), and 8 μL PEG8000 (supplied with ligase) ...
-
bioRxiv - Molecular Biology 2020Quote: The commercial psiCHECK™-2 (Promega) vector was modified by deleting the Rluc poly(A ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U μL-1 RNasin (Promega), 1 mM ATP/GTP/CTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Zoology 2021Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact.
-
bioRxiv - Zoology 2020Quote: ... and 3% 20mg/ml Proteinase K (Promega). Many additional photos of spicules and sections are available in the supplementary data that accompanies this paper ...
-
bioRxiv - Zoology 2022Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Zoology 2024Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Molecular Biology 2022Quote: ... with 100 ug Fugene (Promega, Cat#E2311) in 1.5 mL complete Sf9 medium and added to 100 M Sf9 cells resuspended in 30 mL complete Sf9 medium ...
-
bioRxiv - Genomics 2023Quote: ... 1 ug human DNA (Promega, Madison, WI), 5 ug sheared salmon sperm DNA (Promega ...
-
bioRxiv - Immunology 2020Quote: ... Single CD3-CD8-CD16- CD20+Ova-RBD-PE+RBD-AF647+ B cells were sorted into individual wells of a 96-well plates containing 4 μl of lysis buffer (0.5 X PBS, 10mM DTT, 3000 units/mL RNasin Ribonuclease Inhibitors (Promega, N2615) per well using a FACS Aria III (Becton Dickinson) ...
-
bioRxiv - Plant Biology 2021Quote: ... Selection was done twice for 2 weeks on medium containing 25 µg/ml G418 (Promega, Mannheim, Germany) starting 2 weeks after transformation with a 2-weeks release period in between ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ng/μl of sequencing-grad trypsin (Promega) was added and proteins digested overnight at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 5 μL RNase inhibitor (Promega # N2615), 100 μL 5X reaction buffer (750 mM NaCl ...
-
bioRxiv - Neuroscience 2019Quote: ... Then 5 μL of MTase reagent B (Promega) were added to all of the wells ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Genetics 2019Quote: Buccal cell samples were collected and prepared as for the standard processing method with the exception that 3 μl 5 x AmpSolution™ (Promega Corporation, USA), was added to the PCR reagents in place of low TE buffer ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The amplicons generated from the 5’ and 3’ race PCRs were subjected to purification and subsequent cloning into the pGEM-T easy vector (Promega Corp., WI, USA). The constructed vectors were sequenced (Plasmidsaurus ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of pCS2-HA-NFATc3 was incubated for 2 h at 30°C in 50 μl of the TNT® SP6 coupled wheat germ extract system (Promega, #L5030), according to the instructions of the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein ratio of 1:50 w/w for 2 hours at 37°C and further digested with 30 µL 50 mM TEAB containing trypsin (Sequencing Grade Modified, Promega, Madison, WI) at a trypsin ...