Labshake search
Citations for Promega :
301 - 350 of 2159 citations for Tetratricopeptide Repeat Protein 5 TTC5 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The proteins were digested overnight with trypsin (Promega) at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... the proteins were digested with trypsin (Promega, UK) at an enzyme-to-substrate ratio of 1:100 ...
-
bioRxiv - Molecular Biology 2020Quote: Proteins were digested with sequencing-grade trypsin (Promega) and analyzed by nano LCMS/MS as previously described (Chicher et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were digested with trypsin (MS gold, Promega) 0,1 µg/µl overnight at 37 °C (trypsin ...
-
bioRxiv - Cell Biology 2019Quote: ... Protein was extracted using reporter lysis buffer (Promega), and 25-30 μg of protein were loaded on a 7.5% separating gel using Mini Trans-Blot Cell (Bio-Rad) ...
-
bioRxiv - Systems Biology 2019Quote: ... proteins were digested with sequencing-grade trypsin (Promega) at a 1:40 enzyme-to-substrate ratio for 15 hours at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko 37 ...
-
bioRxiv - Microbiology 2021Quote: ... Digested protein suspensions with 4 μg trypsin (Promega) in 40 μL 25 mM NH4HCO3 buffer at 37 °C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of the Halo-tag protein (Promega), with the insertion of a 45-base linker (15 amino acids ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko49 ...
-
bioRxiv - Microbiology 2020Quote: ... to enable visualization of protein bands (Promega, USA). Each experiment was performed at least three times.
-
bioRxiv - Microbiology 2020Quote: Proteins were digested with sequencing-grade trypsin (Promega) and analyzed by nanoLC-MS/MS on a TripleTOF 5600 mass spectrometer (Sciex ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were digested with trypsin (Promega, Madison, WI) at an enzyme-to-substrate ratio of ~1:50 for 12 hours in a thermomixer ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were proteolytically digested with trypsin (Promega) and purified using OMIX C18 Mini-Bed tips (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... Two hundred μL of protein precipitate solution (Promega) was added ...
-
bioRxiv - Plant Biology 2022Quote: ... total proteins were extracted in lysis buffer (Promega), then Firefly and control Renilla LUC activities were quantified with FLUOstar Omega luminometer (BMG Labtech ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were digested using trypsin (Trypsin Gold, Promega) in a 1:50 protein to enzyme ratio and incubation for 18h at 37°C on a thermo-shaker at 600 rpm ...
-
bioRxiv - Developmental Biology 2021Quote: ... proteins were trypsinized (Sequencing Grade Modified Trypsin, Promega) and digested peptides were collected by centrifugation ...
-
bioRxiv - Neuroscience 2022Quote: ... The proteins were further digested with trypsin (Promega) in 10 ng/µL (enzyme-to-protein ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were then digested with modified trypsin (Promega) at an enzyme/substrate ratio of 1:50 in 100 mM ammonium bicarbonate ...
-
bioRxiv - Microbiology 2019Quote: ... the proteins were proteolytically digested with trypsin (Promega) and purified using OMIX C18 Mini-Bed tips (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were then digested with modified trypsin (Promega) at an enzyme/substrate ratio of 1:50 in 100mM ammonium acetate ...
-
bioRxiv - Biochemistry 2020Quote: ... proteins were digested with trypsin (Promega, Fitchburg, WI) for 14 hours at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko [46] ...
-
bioRxiv - Neuroscience 2020Quote: ... Protein A/G magnetic beads (100 µL) (Promega) were washed with HB prior to addition to the RiboTag-IP fraction and were rotated at 4°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... protein samples were treated with PNGase F (Promega) according to manufacturer’s instruction under denaturing conditions ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested with trypsin (Promega, Madison, USA) at an enzyme-to-protein ratio of 1:100 (w/w ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were digested with sequencing-grade trypsin (Promega) at room temperature while shaking overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... proteins were digested with 0.3 µg LysC (Promega) for 16 h at 37°C followed by a second digestion step with 0.15 µg trypsin (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... proteins were digested with 1 µg trypsin (Promega) and subjected to liquid chromatography (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Ingel protein digestion using trypsin (Promega, Mannheim, Germany) was performed essentially as described before62 ...
-
ALiCE®: A versatile, high yielding and scalable eukaryotic cell-free protein synthesis (CFPS) systembioRxiv - Biochemistry 2022Quote: ... AccuMAP™ Low pH Protein Digestion Kit (Promega) according to the manufactures protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... the proteins were deglycosylated by Endo-H (Promega) followed by PNGaseF (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested with trypsin (sequencing grade, Promega) at 37°C overnight ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko (Shevchenko et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Proteins were then digested with modified trypsin (Promega) at an enzyme/substrate ratio of 1:50 in 100 mM ammonium bicarbonate ...
-
bioRxiv - Microbiology 2023Quote: ... precipitated proteins were first treated with trypsin (Promega) in 50 mM ammonium bicarbonate solution ...
-
bioRxiv - Molecular Biology 2023Quote: Proteins were digested in-gel using trypsin (Promega) according to the method of Shevchenko78 ...
-
bioRxiv - Cell Biology 2023Quote: ... Add 200 μl of Protein Precipitation Solution (Promega) and mix by pipetting ...
-
bioRxiv - Physiology 2023Quote: ... Proteins were digested using sequencing grade trypsin (Promega) at a 1:40 (w/w ...
-
bioRxiv - Neuroscience 2023Quote: ... Purified HaloTag protein (#G4491) was purchased from Promega. Pluronic F-127 (# P3000MP) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Proteins were digested with Lys-C/Trypsin (Promega) at 37 °C overnight with rotation ...
-
bioRxiv - Neuroscience 2024Quote: ... Proteins were digested with trypsin (Promega, Wisconsin, USA) in a ratio of 1:100 at 37 °C ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were on-bead digested with trypsin (Promega) at 37 °C for 16 h with orbital shaking ...
-
bioRxiv - Neuroscience 2024Quote: ... The proteins were digested overnight with trypsin (Promega) at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein precipitations were digested with Trypsin (Promega, #V5113) diluted in Digestion buffer (100 mM Ammonium Bicarbonate and 10% Acetonitrile ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...