Labshake search
Citations for Promega :
301 - 350 of 4312 citations for Cow Casein Kinase II Subunit Alpha 2 CSNK2A2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM EDTA (Promega), and 0.5% (v/v ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and reverse transcribed using the Im-Prom-II Reverse Transcription System (Promega, A3800) and random hexamer primers ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse transcription was performed using the ImProm-II Reverse Transcription System (Promega, A3800) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: Reverse transcriptase (RT)-PCR was carried out using ImProm-II reverse transcriptase (Promega) following the manufacturer’s protocol with 1 µg of RNA ...
-
bioRxiv - Physiology 2020Quote: ... with cDNA produced using the ImProm-II RT system (Promega, Madison, WI, USA). Real-time quantitative PCR was performed using a Prism 7000 (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNase digested and reverse-transcribed using the Improm-II Reverse Transcription System (Promega). qPCR was performed from 100 ng of gDNA using the Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNA synthesis was performed using ImProm-II™ Reverse Transcriptional System (A3800 - Promega) with 1 ug of RNA and RT-qPCR reactions were performed using GoTaq® qPCR Master Mix (A6002 - Promega) ...
-
bioRxiv - Biochemistry 2023Quote: ... in which 50 μL LAR II and 25 μL Stop & Glo reagent (Promega) were added to each well.
-
bioRxiv - Genetics 2024Quote: ... cDNA was synthesized using the ImProm-II™ Reverse Transcription System (Promega, USA). The mRNA composition was established by PCR with plasmid-specific primers ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2020Quote: ... 2 µL FluoroTect GreenLys (Promega), and 375 ng of plasmid encoding the protein of interest ...
-
bioRxiv - Biochemistry 2021Quote: ... and 2 μg LysC (Promega). After digestion ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 µg of AspN (Promega), or 2 µg of GluC (Sigma-Aldrich ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115), 8 pmol of DNA from step 1 and 10 µL T7 HiScribe enzyme ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL RNAse.In (Promega #N2115) and 7 µL TGIRTIII enzyme (InGex) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL RNAse.In (Promega #N2115), 20 μL RNAse-free H2O ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U/μL RNasin (Promega), 1 μM vRNA or cRNA promoter ...
-
bioRxiv - Molecular Biology 2023Quote: The psiCHECK-2 plasmid (Promega) has a special NheI restriction site that was used to insert a synthetic DNA duplex encoding the G-rich region of the PRCC-TFE3 fusion gene in the upstream of the renilla luciferase initiation codon to create the plasmids G4Q27 and G4M27 (mutated G-rich region of the PRCC-TFE3 fusion gene) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...
-
bioRxiv - Neuroscience 2020Quote: ... RNA was reverse transcribed into cDNA using a ImProm-II Reverse Transcription System (Promega). cDNA was mixed with Luna Universal qPCR Master Mix (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA synthesis was performed using random hexamers and ImProm-II™ Reverse Transcriptase (Promega). qPCR was performed with Power SYBR® Green (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... the RNA was reverse-transcribed using ImProm-II™ Reverse Transcriptase (Promega, Massachusetts, USA). Specific intron-spanning primers were used in the PCR and qPCR (Supplementary Table S4) ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA (1 μg) was reverse transcribed with ImProm-II Reverse Transcriptase (Promega, Madison, Wisconsin) using oligo(dT ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA was prepared using ‘ImProm-II™ Reverse Transcription System’ (Promega cat No: A3800) according to the kit protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reverse transcription was carried out using the ImProm-II™ Reverse Transcription System (Promega) using Oligo (dT)20 oligonucleotides for poly-A tail detection ...
-
bioRxiv - Neuroscience 2019Quote: ... or mCherry along with (ii) pGlosensorTM -22F cAMP biosensor plasmid (Promega Corp., Madison, WI), which encodes a modified form of firefly luciferase with a fused cAMP binding moiety providing a biosensor for the direct detection of cAMP signalling in live cells ...
-
bioRxiv - Pathology 2020Quote: ... 30 U of RNasin Ribonuclease Inhibitor and 1.5 µL of ImProm-II™ (Promega). The following parameters were applied ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA synthesis was performed by the ImProm-II™ Reverse Transcription System (Promega) and oligo(dT) ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA synthesis was carried out using random hexamers and Improm-II reverse transcriptase (Promega). The resulting cDNA was used for qPCR via iQ SYBR Green Supermix (Bio-Rad) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA synthesis was performed using random hexamers and ImProm-II™ Reverse Transcriptase (Promega). Quantitative PCR (qPCR ...
-
bioRxiv - Plant Biology 2022Quote: ... and first-strand complementary DNA (cDNA) was synthesized using ImProm-II reverse transcriptase (Promega). Quantitative Reverse Transcription PCR analysis was performed using a CFX96 Real-Time System (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... followed by reverse-transcription into first-strand cDNA using ImProm II reverse transcriptase (Promega), anchored oligo(dN-T20 ...