Labshake search
Citations for Promega :
301 - 350 of 1618 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and 24 hours after media changing the infection was quantified by luciferase detection with BrightGlo luciferase assay (Promega) and read in a Victor3 plate reader (Perkin Elmer ...
-
bioRxiv - Genetics 2021Quote: ... Cultures were incubated for 24 hrs prior to harvest for dual luciferase assay as per manufacturers instructions (Promega).
-
bioRxiv - Developmental Biology 2020Quote: ... After 24 hours luciferase activities were assayed in cell lysates using the Dual-Luciferase Reporter Assay System (Promega) and a multi-label counter (Promega GloMax) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were collected at 24 h after the induction of differentiation and dissolved in Passive Lysis Buffer (Promega). The effect of hnRNPK on myogenin promoter was measured using a Lumat LB 9507 luminometer (Berthold Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were plated in 24-well plates and transfected with 0.25 μg plasmid DNA and 1.25 μL FuGENE (Promega). Primary neuronal culture was prepared as described previously (40) ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were incubated for 24 hrs and the luciferase activity was evaluated by a luciferase assay (Promega). Luminescence was measured with Synergy Neo 2 microplate reader (Biotek) ...
-
bioRxiv - Microbiology 2020Quote: ... The dual luciferase assay was performed 24 h post-transfection using the Dual-Glo Luciferase Assay System (Promega).
-
bioRxiv - Cancer Biology 2021Quote: ... Luciferase activity was measured 24 hours after plasmids transduction by lysing the cells in the Passive Buffer (Promega) and combining equal volumes of cell lysates with the Bright-Glo™ Reagent (Promega) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200µL (for 48-well plate format) or 400µL (for 24-well plate format) complete DMEM with or without 10µM furimazine (Promega). Cells were incubated at 37°C under 5% CO2 either in the dark ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 24 h and viability was measured following a 6 h incubation with CellTiterBlue (Promega). Viability was quantified by fluorescent measurement (Ex ...
-
bioRxiv - Neuroscience 2020Quote: 80,000 HEK293T cells were plated in 500μl HEK Media and 24 hrs later 500ng total plasmid DNA was transfected with 1.5μl FuGene HD (Promega) as follows ...
-
bioRxiv - Genomics 2023Quote: ... Cells were lysed 24 h after transfection and assayed with the Dual-Luciferase Reporter assay kit (Promega, E1960).
-
bioRxiv - Molecular Biology 2022Quote: ... Luciferase luminescence intensities were measured 24 hours after transfection using the Dual-Luciferase® Reporter Assay System (Promega). The luminescence intensities of firefly luciferase were normalized to that of Renilla luciferase ...
-
bioRxiv - Molecular Biology 2022Quote: ... Luminescence was measured in cell lysates 24 h after transfection using the Dual Luciferase Reporter Assay Kit (Promega) on a Victor X luminometer (Perkin Elmer ...
-
bioRxiv - Biophysics 2024Quote: ... Cells transduced with MCP-HALOnls were incubated for 24 hours before overnight staining with HaloTag-JF646 (Promega, #GA1120) at 10 μM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Luciferase activities were assayed 24-48 hours after transfection using a luciferase reporter assay system (Cat#: E1500, Promega) as previously described(30).
-
bioRxiv - Molecular Biology 2023Quote: ... Relative luciferase activity was measured 24 h post-transfection with the Dual-Glo Luciferase Assay System (Promega, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... the day after plating (3.45 × 104 cells/well in a 24-well plate) using FuGENE HD (Promega, E2312). After 48-h incubation ...
-
bioRxiv - Bioengineering 2024Quote: ... The plate was incubated for 24 hours and transfection efficiency measured using Bright-GloTM Luciferase Assay System (Promega). Briefly ...
-
bioRxiv - Genomics 2024Quote: ... Cells were cultured for 24 h before performing luciferase assay using Dual-Glo Luciferase/Renilla Assay System (Promega) and Infinite 200 Pro plate reader (Tecan Ltd ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cells were seeded in 6-well plates at 400,000 cells/well and transfected after 24 hours using 1μg of plasmid and Fugene6 (#E2691, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 assay reagents (Promega, WI, USA) were added to each well according to the manufacturer’s instructions (ratio of 1:4) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3’-UTR derived from pNL1.1[Nluc] vector (Promega), and 50 nt poly(A ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase-Glo® 3/7 Assay System (Promega) was used according to manufacturer’s guidelines ...
-
bioRxiv - Systems Biology 2020Quote: ... and T4 DNA ligase (3 U/μί, Promega) were applied to assemble all of the synthetic promoter blocks sequentially and simultaneously into the firefly reporter vector backbone in a one-pot reaction ...
-
bioRxiv - Cancer Biology 2020Quote: Caspase 3/7 Assay kit (Promega, Southampton, UK) was utilized to assess apoptosis as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Caspase-Glo 3/7 assay (Promega, Madison, WI) (5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Caspase-Glo 3/7 Assay (Promega, Cat# G8090) reagent was added to the cells and incubated for 30 min ...
-
bioRxiv - Bioengineering 2022Quote: ... by Caspase-Glo® 3/7 Assay (Promega) using GloMax Discover Microplate Reader (Promega).
-
bioRxiv - Biochemistry 2021Quote: ... 1.8 nM 3 kb supercoiled pGEMT plasmid (Promega), and 20 nM MMTV intasomes in a final volume of 15 µL ...
-
bioRxiv - Cancer Biology 2023Quote: ... The caspase 3/7 (Caspase-GloTM Promega G8090) level was measured per the manufacturer’s instructions.
-
bioRxiv - Zoology 2023Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cancer Biology 2024Quote: ... Caspase-Glo 3/7 3D Assay (Promega, #G8981) was added and the mixture incubated per manufacturer instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase-Glo 3/7 Assay (Promega, Fitchburg, WI) and ROS-Glo H2O2 Assay (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... or Caspase-Glo® 3/7 (Promega, USA) respectively ...
-
bioRxiv - Zoology 2024Quote: ... and 3% 20 mg/ml Proteinase K (Promega). This method removed cellular material while preserving spicules and the spongin network (if present) ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Bioengineering 2020Quote: The therapeutic effect of free taxane (pro)drugs and LNP formulations was determined by the [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) or the resazurin-based PrestoBlue assay (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...