Labshake search
Citations for Promega :
3251 - 3300 of 3631 citations for Human Gastric Intrinsic Factor GIF CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: The ADCC or cell killing activity of effector cells incubated with anti-NKG2A antibodies with LALA-PG mutation were measured through release of cytosolic LDH from dead target cells using LDH-Glo cytotoxicity assay kit (Promega, J2381). The purified NK cells from normal PBMCs (Zenbio Inc. ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial counts were obtained by comparing the signals from the tested samples with a standard curve prepared by serial dilutions of a standard sample purified using the WizardSV Gel and PCR Clean-Up System Kit (Promega, USA) and subsequently cloned into the pGEM-T vector (Promega ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... probe was generated by an in vitro transcription system using primer pairs with T7 and SP6 promoter regions (T7 and SP6 Ribomax™ large scale RNA kit, Promega) (Mlig-pro46 ...
-
bioRxiv - Plant Biology 2019Quote: ... Grown cultures were used for DNA isolation using Wizard Genomic DNA Purification Kit following the manufacturer’s instructional manual (Promega, Madison, WI).
-
bioRxiv - Pathology 2019Quote: ... Lactate Dehydrogenase (LDH) release was measured regularly (twice per week) using a CytoTox 96® Non-Radioactive Cytotoxicity Assay kit (Promega).
-
bioRxiv - Physiology 2019Quote: In vitro transcription was performed using T3 RNA polymerase and other reagents supplied in the RiboProbe In Vitro Transcription System kit (Promega, Italy) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... Root tissue was ground in liquid nitrogen and total RNA was extracted with the Maxwell® 16 LEV plant RNA kit (Promega) in the Maxwell 16 AS2000 instrument (Promega) ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Effects of compounds on NR4A2-AB-Gal4DBD activity was determined via end-point luciferase measurement using a Luciferase Assay System kit (Promega, Inc). The response to 6-MP (3-4-fold maximal induction ...
-
bioRxiv - Cell Biology 2019Quote: ... We then assessed cell viability of treated and control cells 48 hours post-transfection using the CellTiter Glo 2.0 luciferase assay kit (Promega, Madison, WI) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Luciferase activity was assessed using the dual-luciferase reporter kit (TransGene, China) and performed via a dual-luciferase reporter assay system (Promega, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... 0.6 or 1 μg extracted RNA was converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Microbiology 2021Quote: ... cytotoxicity tests were performed in Vero E6 cells via MTS assay using the CellTiter 96® Non-Radioactive Cell Proliferation kit (Promega) as previously described (37) ...
-
bioRxiv - Cell Biology 2020Quote: ... and results were normalized to living cell numbers as evaluated with the CellTiter 96® AQueous One Solution Cell Proliferation Assay Kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2020Quote: Total mRNA was isolated from tissues using a Maxwell® LEV simply RNA Cells/Tissue kit (cat# AS1280, Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was extracted from samples using Maxwell® 16 automated system (Maxwell® 16 Cell DNA kits, Promega, Madison, WI, USA). Extracted DNA samples were quantified using NanoDropTM 2000 UV-Vis Spectrophotometer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... and real-time PCR was performed on 30 ng of DNA with SYBR Green kit GoTaq® qPCR Master Mix (Promega). DNA from non-transduced cell was isolated and amplified at the same time to demonstrate the absence of contamination ...
-
bioRxiv - Synthetic Biology 2020Quote: ... we found we did not obtain clean results unless we first used a genomic miniprep kit to purify DNA (Promega Wizard). We inverted the colors for all agarose gels to assist visualization.
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Immunology 2021Quote: CD8+ T cell cytotoxicity was assessed using a Cyto Tox 96® Non-radioactive Cytotoxicity Assay kit (Promega, Cat no. G1780) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: RNA was isolated from single pupal terminal samples dissected at 24 hours APF or 28 hours APF using the Maxwell® 16 Tissue DNA Purification Kit (Promega). Poly-A RNA-seq libraries were generated using a Clontech library preparation kit (040215) ...
-
Quantitative three-dimensional nondestructive imaging of whole anaerobic ammonium-oxidizing bacteriabioRxiv - Cell Biology 2019Quote: ... The resulting PCR products were extracted from 2% agarose gel and further purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences) and were quantified by QuantiFluor™-ST (Promega).
-
bioRxiv - Plant Biology 2019Quote: ... The PCR products were purified using a HiPure Gel Pure DNA Mini Kit (Magen, D2111) and cloned into the pGEM-T Easy Vector (Promega, A1360). For each sample ...
-
bioRxiv - Synthetic Biology 2019Quote: Measurements of luminescence intensity from the amber initiator plasmid system was performed as before15 using the NanoYGlo Luciferase Assay System kit (Promega, #N1110) with the following modifications ...
-
bioRxiv - Genomics 2021Quote: ... the strain was cultivated on PD2 medium as described (Su et al., 2016) for DNA extraction using Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2020Quote: Yeast genomic DNA was prepared from 1 ml cultures grown in rich media from single colonies or Ade− half-sectors using the Wizard® Genomic DNA Purification Kit (Promega). Genomic DNA (150 ng ...
-
bioRxiv - Genetics 2020Quote: Molecular confirmation of HDR-mediated target site integration of the Reckh cargo was performed on genomic DNA extracted from single GFP+ black-eyed individuals using the Wizard® genomic DNA purification kit (Promega). Primers Kh1-ext-fw (CACTGTTGGCACTCCATCTG ...
-
bioRxiv - Cell Biology 2020Quote: ... The resulting lysates were used to measure the humanized renilla (hRluc) and firefly (hluc) luciferase activities with the Dual-Luciferase Reporter Assay kit (Promega, E1960) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... The NAD+/NADH ratio was measured using a protocol adapted from the manual of the NAD/NADH-Glo Assay kit (Promega G9072)2 ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) according to manufacturer’s instructions and quantified using Quantus™ Fluorometer (Promega, USA). The qualified PCR products were mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... then left for 48 hrs before measuring the ATP content using CellTiter-Glo® assay kit (Promega, Madison, WI, USA, G7570) [47] ...
-
bioRxiv - Physiology 2021Quote: ... Extracts were used for quantification of luciferase as proxy for ATP content using the ENLITEN® ATP Assay System Bioluminescence Detection Kit (Promega) according to the manufacturer instructions ...
-
bioRxiv - Cancer Biology 2020Quote: To isolate RNA from cell lines we followed the manufacturer's instructions of the Maxwell 16 LEV simply RNA Kit (# AS1280) (Promega, Walldorf, Germany). Quantification of mRNA was performed using the BRYT Green® Dye (GoTaq® qPCR ...
-
bioRxiv - Genetics 2021Quote: Total RNA was extracted from cultured cells or frozen adipose tissue using the Eastep Super Total RNA Extraction Kit (Promega (Beijing) Biotech Co. ...
-
bioRxiv - Cancer Biology 2021Quote: ... The viability of the cultures was determined 24 h and 48 h after EV treatments by using the CellTiter-Fluor cell viability assay kit from Promega (G6080) following manufacturers instructions ...
-
bioRxiv - Microbiology 2021Quote: ... supernatant was harvested from Calu-3 cells and inactivated by addition of lysis buffer (Maxwell 16 viral total nucleic acid purification kit, Promega #AS1150) complemented with proteinase K ...
-
bioRxiv - Microbiology 2021Quote: RNA from lysed and heat-inactivated samples was purified according to the instructions of the manufacturer using Maxwell 16 viral total nucleic acid purification kit (Promega, #AS1150) or Maxwell 16 LEV simplyRNA cell kit (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was assessed three days post-infection by MTS assay using the CellTiter 96® Aqueous Non-Radioactive Cell Proliferation kit (Promega) and absorption was measured at 495 nm with an EnVision Multilabel Plate Reader (PerkinElmer) ...
-
bioRxiv - Immunology 2021Quote: MSCs and B cells proliferation were measured using the CellTiter 96® AQueous cell proliferation assay kit from Promega (Madison, WI) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... small leaves and witches’ broom) (Figure 1B) were collected for total genomic DNA extraction using the Wizard Genomic DNA Purification Kit (A1120; Promega, USA). For Illumina sequencing ...
-
bioRxiv - Genetics 2019Quote: ... with a Maxwell 16 instrument using Maxwell 16 LEV SimplyRNA Blood kits according to the manufacturer’s protocol (Promega, Madison, WI, USA). Complementary DNA (cDNA ...
-
bioRxiv - Genomics 2021Quote: Genomic DNA was extracted from the aerial portions of 10-day old seedlings using the Wizard® Genomic DNA Purification Kit (Promega) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The radioactively labeled probe was first prepared with γ[32 P]ATP ATP and DNA oligonucleotides listed in Supplementary Table S5 with a T4 polynucleotide kinase kit (Promega), purified on MicroSpin G-25 (GE Healthcare ...
-
bioRxiv - Microbiology 2022Quote: Total RNA from each lung homogenate and nasal wash was isolated using the Maxwell RSC Maxwell RSC Viral Total Nucleic Acid Purification Kit (Promega Corporation), following the manufacturer’s suggested protocol ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Cancer Biology 2022Quote: ... The first strand cDNA was reverse transcribed from the RNA templates using the GoScript Reverse Transcription system kit (Promega, United States) and Oligo(dT)15 primers (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... by quantifying the activity of lactate dehydrogenase (LDH) released into the supernatant using a colorimetric assay (CytoTox 96® Non-Radioactive Cytotoxicity Assay kit from Promega) and following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: Total RNA was extracted from fBECs of WT and Gpr126iECKO mice at P18 using Maxwell RSC simplyRNA tissue kits with the Maxwell RSC Instruments (Promega Corporation). The amount of RNA was measured using the Nanodrop technique and its integrity assessed using Agilent Bioanalyzer 2100 with Nano RNA kits (RIN > 8) ...