Labshake search
Citations for Promega :
3151 - 3200 of 5313 citations for 6 Bromo 3 3H imidazol 4 ylmethylene 1 3 dihydro indol 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 1 μg of trypsin (Promega, V5280) was added ...
-
bioRxiv - Neuroscience 2024Quote: ... bIII-tubulin (1:1000, Promega, G7121), LMX1(1:500 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 µl 1% digitonin (Promega,#G9441), 0.1 µl 10% Tween-20 (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... anti-LgBiT (1:500, N7100, Promega), anti-MCPyV LT (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml FuGENE HD (Promega, E2312) transfection mix containing 30 μl FuGENE HD and 8 μl of each plasmid was prepared per plate ...
-
bioRxiv - Microbiology 2023Quote: ... A 1 kb DNA ladder (Promega) was used as a size marker ...
-
bioRxiv - Immunology 2023Quote: ... 1 mmol/L dithiothreitol (V315A, Promega), 5 mmol/L β-glycerophosphate (G6376 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 g of firefly luciferin (Promega) was dissolved in 66.6 mL of sterile PBS to create a 15 mg/mL solution ...
-
bioRxiv - Microbiology 2023Quote: ... 1 µg of modified trypsin (Promega) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-Halo (1:1000, mouse, Promega), anti-Myc (1:100 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µl Reverse Transcriptase (Promega, M314A). Thermal cycling was as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 µl Reverse Transcriptase (Promega, M314A), was added to each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1:250 RNasin (Promega, #2515). Centrifugally clarified cell extracts were incubated with affinity medium (20 μl of slurry for αORF1p and αORF2p for 30 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Beta III Tubulin (1:2000, Promega), and PSD-95 (1:100 ...
-
bioRxiv - Immunology 2023Quote: ... 1 Inflammasome Assay was from Promega. HTRF kits to detect IL-1b ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:100 RNasin Plus (Promega N2615), and 1:200 Alexa Fluor 488 anti-GFP antibody (BioLegend 338007 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... against 1 kb DNA ladder (Promega) and photographed under UV illumination (see Supplementary Figures S3 and S4 for examples) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 10 U μl-1 RNAsin (Promega), 1Å∼ Superscript II First-Strand Buffer ...
-
bioRxiv - Biophysics 2024Quote: ... 1% unmethylated Lambda DNA (Promega #D1521) was spiked into genomic DNA to monitor bisulfite conversion efficiency ...
-
bioRxiv - Immunology 2024Quote: ... 1 µg sequence grade trypsin (Promega) was added overnight at 25°C ...
-
bioRxiv - Microbiology 2024Quote: ... rabbit anti-Halo (1:300, Promega), rabbit anti-H3K9me3 (1:300 Abcam ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg trypsin (Promega, Fitchburg, USA) was used to digest 50 μg of total solubilized protein from each sample ...
-
bioRxiv - Systems Biology 2024Quote: ... 1 μL of random hexamers (Promega), and brought to 20 μL total volume with nuclease-free water ...
-
bioRxiv - Physiology 2024Quote: ... HRP Conjugate (1:2,500, Promega, W4011) secondary antibody for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay as described previously [20] or by CellTiterGlo assay (Promega, Walldorf, Germany) following the manufacturer’s instructions after 120h incubation.
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Peptide digestion was initiated by adding 25 μl of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 μg trypsin (Sequencing Grade Modified Trypsin, Promega #V5117) directly on top of the column and incubating overnight at 37 °C in a drying oven ...
-
bioRxiv - Zoology 2019Quote: ... Traces of genomic DNA were removed by treating 2 μg of the total RNA with RQ1 RNase-Free DNase (Promega, USA). First-strand cDNA was synthesised from RNA using the M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Molecular Biology 2020Quote: ... cell pellets were lysed in polysome lysis buffer (gradient buffer containing 100 mM KCl, 10 mM MgCl2, 0.1% NP-40, 2 mM DTT, and 40 U/ml RNasin; Promega, Leiden, Netherlands), and onto 17–50% sucrose gradients and ultracentrifuged for 2 h at 40,000 rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... the final volume was brought to 80 ml with Lysis Buffer+2 mM CaCl2 and incubated with 1000U of RQ1 DNase (Promega-PRM6101) for 30min at RT ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... The resulting protein extract was first diluted to 2M urea for overnight digestion with LysC (Wako, USA) at 37°C and then diluted 2-fold for 8 h digestion with trypsin (Promega, USA) at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 106 cells of each strain were mixed completely with equal volumes of the BacTiter-Glo reagent (Promega Corporation, Madison, WI), followed by incubation at room temperature for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the treatment was removed from the wells and the cells were incubated with 100 μl of EGM™-2 complete medium with 20 mM HEPES and 20 μl of MTS (Promega, CellTiter 96® AQueous One Solution Reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...