Labshake search
Citations for Promega :
3101 - 3150 of 3802 citations for Mouse CXCL9 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Caspase 3/7 activity was measured using a luminescence Caspase Glo 3/7 assay kit (G8090; Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: NAD+/NADH and NADPH/NADP+ measurements were performed by enzymatic cycling reaction assay kits (NADH-Glo and NADPH-Glo, Promega). 4×104 cells were resuspend in 50 μL of PBS and were lyzed by adding 50 μL of NaOH-DTAB buffer containing 1% w/v dodecyltrimethylammonium bromide (DTAB ...
-
bioRxiv - Cancer Biology 2022Quote: GSH/GSSG measurement was performed by a glutathione S-transferase (GST) enzyme coupled reaction using (GSH/GSSG Glo kit, Promega). Cells (2×104 ...
-
bioRxiv - Cell Biology 2022Quote: hCO viability after 6 days of doxo treatment was assessed by CellTiter-Glo® Luminescent Cell Viability Assay Kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... ATP content was determined by a luciferase-based ATP bioluminescence assay kit (BacTiter-Glo™ Microbial cell viability assay, Promega). Luminescence values were determined using a 10 sec RLU signal integration time and measured using a Centro XS3 LB960 Luminometer (Berthold Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... Genomic DNA from T0 and T9 (IgA+, IgA- and unsorted) samples was extracted using the Wizard Genomic DNA Purification kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and reporter activation quantitated as the ratio of firefly luciferase (FFluc)/Renilla luciferase (Rluc) activity measured using the Dual-Glo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR amplified inserts were run on a 1% agarose gel and purified using the Wizard SV Gel and PCR Clean-Up System kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Cell viability assays in response to drug or DMSO treatment were performed using CellTiter-Glo Luminescent Cell Viability kit (Promega) in cells grown in 96-well plates (Greiner ...
-
bioRxiv - Molecular Biology 2021Quote: ... Renilla and Firefly Luciferase signals were read in a MicroLumat Plus LB96V luminometer by using the Dual Luciferase Reporter Assay kit (Promega) following the manufacturers’ instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... The total RNA (1-2 μg) was reverse transcribed with a GoScript™ Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was isolated with the Maxwell RSC Viral Total Nucleic Acid Purification Kit on a Maxwell RSC 48 instrument (Promega). Isolated ZIKV RNA was titrated by qRT-PCR using TaqMan Fast Virus 1-Step Master Mix (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were harvested after another 24 hours and firefly luciferase and Renilla luciferase expression were determined using the Dual-Luciferase Assay Kit (Promega).
-
bioRxiv - Plant Biology 2021Quote: Total plant RNA extraction and DNAse treatment were performed using the SV Total RNA Isolation Kit (Promega, Madison, WI, USA), followed by Reverse Transcription with SMART ® MMLV (Takara Bio USA ...
-
bioRxiv - Physiology 2020Quote: ... For the RNA sequencing samples the isopropanol phase of TRIzol extraction was transferred to Reliaprep tissue Miniprep kit (Promega, USA) columns to ensure high quality RNA samples were used ...
-
bioRxiv - Microbiology 2021Quote: ... Five ml of BHI broth containing 10 μg/ml tetracycline was inoculated with a single colony and genomic DNA was extracted (Wizard DNA extraction kit, Promega). Genomic DNA was sequenced by paired-end joining Illumina (Biomics Platform of the Institut Pasteur ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Luciferase activity was measured after 48 hours (with or without drug treatment) using Reporter Lysis Buffer kit (Promega, Madison, WI) per manufacturer’s instructions and a Synergy H4 plate reader.
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting product was used to perform luciferase assays using Nano-Glo® Dual Reporter Assay kit (Promega, WI, USA) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cell lysis and luciferase assays were performed using the Dual-Luciferase® Reporter Assay System kit (Promega Corporation, Madison, WI). Luciferase units were measured with a Spark microplate reader (Tekan Group Ltd. ...
-
bioRxiv - Microbiology 2022Quote: ... 1 mL of bacterial culture was pelleted at 15,000 x g for 15 min at 4 °C then samples were prepared according to the directions for the Wizard HMW DNA Extraction kit for Gram-negative Bacteria (Promega). The University of Michigan Microbiome Core quantified the genomic DNA samples ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was measured using the CellTiter Glo Luminescent Cell Viability Assay kit according to manufacturer’s protocol (Promega, Madison, WI).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was measured using the CellTiter Glo Luminescent Cell Viability Assay kit according to manufacturer’s protocol (Promega, Madison, WI).
-
bioRxiv - Evolutionary Biology 2022Quote: ... we extracted RNA from the whole body using a modified Trizol RNA extraction procedure with the Purelink RNA Purification Kit (Promega), followed by amplification of the product with the Ovation RNAseq System V2 (Tecan ...
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Genetics 2020Quote: ... Using the primers provided in Supplementary Table 3 we performed PCRs on 40 ng of genomic material extracted from wild type mosquitoes of the G3 strain using the Wizard Genomic DNA purification kit (Promega). The primers were modified to contain suitable Gibson assembly overhangs (underlined ...
-
bioRxiv - Genetics 2020Quote: ... They were grown to adulthood and their gDNA was individually extracted using either the Wizard Genomic DNA purification kit (Promega) or the DNeasy Blood & Tissue Kit (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pro-apoptotic caspase 3/7 activation was measured in worms harvested from mice following drug treatment using the Caspase-Glo 3/7 Assay Kit (Promega). Worms were harvested from either the mesenteries or liver of mice ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were harvested by trypsinization and RNA was isolated using Maxwell LEV simply RNA Cells/Tissue Kit (Promega, Madison, USA), according to the company’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... Both human cell lines were validated using the cell line authentication service at Duke University and confirmed using the GenePrint 10 kit from Promega and tested to be mycoplasma-free ...
-
bioRxiv - Plant Biology 2019Quote: ... Ten µl of each cell lysate were used for dual luciferase assay by applying 50 µL of freshly prepared LARII and Stop&Glo reagents of the Dual Luciferase Assay kit (E1910, Promega). The luciferase intensity values of firefly and Renilla luciferases were measured sequentially by collecting one second of integrated chemiluminescence intensity (using gain 240 ...
-
bioRxiv - Plant Biology 2019Quote: ... Ten µl of each cell lysate was then transferred into another plate and used for dual Luciferase assay applying a quarter of the recommended volume of each reagent of the Dual Luciferase Assay kit (E1910, Promega). The substrates were added by an automated pump of the FLUOstar Omega Microplate Reader (BMG LABTECH ...
-
bioRxiv - Cancer Biology 2020Quote: ... All cell lines were validated by DNA fingerprinting through the University of Colorado Molecular Biology Service Center utilizing the STR DNA Profiling PowerPlex-16 HS Kit (DC2101, Promega)(Table S4).
-
bioRxiv - Microbiology 2019Quote: ... synthesized by in vitro transcription of a NdeI-linearized pGEM-T plasmid containing the 135bp cDNA target fragment using the T7 RiboMAX in vitro transcription kit (Promega). Negative controls (without template RNA and RNA from mock-infected cells ...
-
bioRxiv - Immunology 2019Quote: ... Viral RNA was extracted from 300μL of plasma using the Viral Total Nucleic Acid Purification kit (Promega, Madison, WI, USA) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Pathology 2020Quote: The cellular ATP levels were quantified in 100 μL ATP assay buffer or from 20-30 mg wound skin harvested in 200 μL assay buffer and lysed with the bead shocker following the manufacturer’s instructions (CellTiter-Glo luminescent ATP assay kit, Promega, Madison). The protein content from identical treated cells or tissues were determined by BCA Protein Assay kit for normalization (Young ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Genomic DNA from the 20 renal cortical tissues procured from the NIH NeuroBioBank were isolated using Wizard genomic DNA purification kit (Promega). The following forward (CCACAAGGGCAGAAAGTATG ...
-
bioRxiv - Genomics 2019Quote: ... The reporter plasmids and β-gal expression plasmids were cotransfected in K562 cells and luciferase assay was carried out after 48 hours using Nanoglo luciferase kit (Promega) and normalized to ß-gal expression measured using assay reagent (ThermoFisher).
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Plant Biology 2020Quote: ... The overlapping PCR products were separated and purified by the Spin Column PCR Product Purification Kit (Wizard SV Gel and PCR Clean-Up System) following manufacturer’s instruction (Promega, WI). Then ...
-
bioRxiv - Bioengineering 2020Quote: We used the method of ATP-based luminescent cell viability assay with the Kit named CellTiter-Glo Luminescent Cell Viability Assays (Promega). 5×104 cells in 100 μL of DMEM medium per well were seeded in a 96-well opaque white polystyrene microplate (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase digestion of cellular RNA was verified by purifying RNA from supernatant after immunoprecipitation using Reliaprep RNA purification kit (Promega) and then analyzing it by denaturing formaldehyde-agarose gel electrophoresis followed by imaging of the ethidium bromide stained gel.
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was purified from 2 × 106 HCT116 cells harvested 48 hr following reporter transfection using the SimplyRNA cells kit and Maxwell RSC instrument (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: The AP-1 luciferase reporter was expressed using an adenoviral vector and luciferase activity determined using a luciferase assay kit from Promega as previously described (Higazi et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... were detected by the alteration of the dose-response curve measured using CellTiterGlo Chemoluminescent Kit (Promega Corporation, Cat. No.: G7573). Cell lines were confirmed to be mycoplasma-negative using the Mycoalert PLUS Mycoplasma detection kit (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... coli was grown in NB liquid medium (180 rpm, at 30 ° C) and had its DNA extracted with Wizard Genomic DNA Purification Kit (Promega). The number of bacteria in the seed and root was calculated based on the values of Ct (cycle threshold ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were harvested at various time points of differentiation over a period of 11 days and then analyzed using a Dual-Glo luciferase assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and then excised and purified using the Wizard® SV Gel and PCR Clean-Up System kit (Promega, Madison, WI) according to manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Amplification products were checked on a 1% agarose gel and were purified using the Wizard PCR clean-up kit (Promega). DNA concentration and purity were measured using a ND-1000 UV-Vis Spectrophotometer (Nanodrop Technologies).