Labshake search
Citations for Promega :
2951 - 3000 of 3802 citations for Mouse CXCL9 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Amount of ATP release in response to compound were measured by Celltiter-Glo 2.0 cell viability assay kit (Promega) as per the manufactures’ protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega). All experiments were performed in biological triplicates.
-
bioRxiv - Biochemistry 2023Quote: ... Luminescence values were normalized by amount of live cells in vehicle control-treated wells (CellTiter-Glo 2.0 Assay Kit, Promega). CTG reagent was added to vehicle control-treated wells in triplicate 15 min after addition of the cAMP-glo Max Assay kit ONE buffer.
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: Total cholesterol and triglycerides from cells were determined by using Cholesterol/Cholesterol Ester-GlowTM assay kit (Promega, Madison, WI) and Triglyceride-GlowTM assay kit (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... The number of viable cells was determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega G3580) and absorbance at 490 nm was measured by a plate reader (CLARIOstar ...
-
bioRxiv - Genomics 2023Quote: ... Protocol for cell lysis and measurement of the activities of the firefly luciferase (Dual-Luciferase Reporter Assay kit, Promega), with normalisation using the Renilla luciferase activity ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were collected for a luciferase activity assay using a dual-luciferase assay kit (Promega, Madison, WI, USA). The normalized luciferase activity was obtained by using the formula ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Total RNA was extracted using the Maxwell® RSC instrument together with the Maxwell® simplyRNA Tissue Kit (Promega) according to the manufacturer’s instructions with a final elution volume of 60 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... lactate dehydrogenase (LDH) release assay was performed using CytoTox 96 Non-Radioactive Cytotoxicity Assay kit (Promega, Madison, Wisconsin, USA) according to manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2023Quote: ... All mRNAs were prepared using the Ambion mMessage Machine kit using Sp6 (#AM1340) supplemented with RNAse Inhibitor (Promega #N251B).
-
bioRxiv - Developmental Biology 2023Quote: ... Ghost Database KY21.Chr1.1715) we extracted genomic DNA from local Norwegian animals using the Wizard Genomic DNA Purification Kit (A1120, Promega). We then used the purified gDNA at a concentration of 100-150ng/μl ...
-
bioRxiv - Immunology 2023Quote: ... Cells were lysed on the plate and incubated with luminescence glo regents per the luminescence glo assay kit’s instructions (Promega). Luminescence was recorded using a BioTek Synergy2 plate reader.
-
bioRxiv - Cell Biology 2023Quote: DNA was prepared from bacterial cultures grown at 37°C using a Midiprep kit (PureYield Plasmid Midiprep System, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The intracellular NAD+ in 3T3-L1 cells or ASCs was measured using the NAD+/NADH-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 ng of total RNA was transcribed to cDNA using the ImProm-II™ reverse transcription kit (Promega, A3500) with random primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Renilla and Firefly luciferase activities were measured on a luminometer using the Promega dual luciferase kit (Promega, E1910) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega) at 24 ...
-
bioRxiv - Genetics 2023Quote: ... RNA (1000 ng input) was subsequently reverse-transcribed to cDNA using random primers and the GoScript RT kit (Promega). RT-qPCR was performed using FIREPoly qPCR Master Mix (Solis BioDyne ...
-
bioRxiv - Genomics 2023Quote: ... Protein was precipitated by the addition of 200 μl Protein Precipitation Solution (Promega Wizard HMW DNA Extraction Kit A2920). Using a wide bore tip the samples were mixed by drawing up contents from the bottom of the tube and then expelled on the side of the tube 5 times ...
-
bioRxiv - Genomics 2023Quote: ... The total cellular DNAs of the activated CD4+ T cells were isolated using a DNA extraction kit (Promega Wizard) for analysis.
-
bioRxiv - Microbiology 2023Quote: ... Total genomic DNA was isolated from overnight cultures of Ag1 and Ag2 using the Genome Wizard kit (Promega, WI), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... cells were collected to measure the firefly luciferase and renilla luciferase luminescent activities using the Dual-Luciferase Reporter Assay kit (Catalog:E1910, Promega) with 96-well plates (Nunc MaxiSorp ...
-
bioRxiv - Microbiology 2023Quote: ... The sequence of the plasmid was verified by sequencing using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega). To generate a pDON-5 Neo-vector expressing IFNAR1 with the W70C mutation ...
-
bioRxiv - Genomics 2023Quote: ... DNA of plant selected at this stage was extracted from rosette leaves using Wizard Genomic DNA Purification kit (Promega) and digested with methylation-sensitive restriction enzyme (MspI or CfoI ...
-
bioRxiv - Plant Biology 2024Quote: ... The complete amount of RNA was reverse transcribed to cDNA using the oligodT from the GeneRacer kit and following the manufacture’s guide of ImProm-II Reverse Transcriptase (Promega). The PeSPL6 and PeSPL13a 5’-ends were amplified by PCR using the GoTaq Master mix (Promega) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Cell survival was measured three days later using CellTiter-Glo luminescent cell viability assay kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2024Quote: ... All amplicons were then verified by gel electrophoresis and purified using a Wizard Gel Purification kit (Promega, Madison, WI).
-
bioRxiv - Microbiology 2023Quote: ... UTI-59 DNA for long-read sequencing only was extracted using the Wizard HMW DNA Extraction Kit (Promega, USA) following the manufacturer’s instructions excepted eluted in molecular grade water ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid sequence was verified using a SupreDye v3.1 Cycle Sequencing Kit (M&S TechnoSystems, Osaka, Japan, Cat# 063001) with a Spectrum Compact CE System (Promega).
-
bioRxiv - Neuroscience 2023Quote: RNA from lyophilized cerebrum and brainstem samples was extracted using the Maxwell® RSC simplyRNA Tissue Kit/Instrument (Promega) with initial homogenization on a TissueLyser LT (Qiagen) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from FFPE samples (Discovery Cohort) using Maxwell 16 LEV RNA FFPE Kit (Promega, Madrid, Spain), following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: NAD+ and NADH measurements were done with the NAD/NADH-Glo Assay Kit (#G9071 from Promega, Madison, WI, USA). Cells were grown in 24-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... 25 µl of CellTiter-Glo® reagent from CellTiter-Glo® luminescent cell viability assay kit (Promega, Southampton, UK) was added to each well and mixed for 2 minutes on a plate shaker and incubated at room temperature (RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Caspase CP and CAEC apoptosis was determined after treatment with hemin or vehicle using a Caspase glo kit (Promega) according to manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1-2 μg) was reverse transcribed with a GoScriptTM Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation ...
-
bioRxiv - Bioengineering 2024Quote: ... The hDF metabolic activity was measured with the CellTiter 96 ® Aqueous MTS Kit (Promega Corp., Madison, WI, USA). At each timepoint ...
-
bioRxiv - Cancer Biology 2023Quote: Total GSH levels in cells were detected by using luminescence-based GSHGlo Assay reagent kit (Promega, catalogue no. B6912) as instructed by the manufacturer ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Females from each progeny were then pooled to perform genomic DNA extraction (Wizard® Genomic DNA Purification Kit, Promega) and subsequently do amplicon sequencing on the dsx target to check the frequency of the dsxFΔ11 allele in the offspring ...
-
bioRxiv - Microbiology 2024Quote: The oxidized glutathione (GSSG) and reduced glutathione (GSH) were individually measured by employing the Glutathione Assay Kit (Promega, USA) as described by Nakagawa et al ...
-
bioRxiv - Cell Biology 2024Quote: ... we isolated individual clones and screened for expression using the C-terminal nanoluc fusion (Nanoluc Lytic Detection Kit, Promega), followed by additional characterization of SMO agonist-induced ciliary accumulation via microscopy ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The plasmid DNA was purified from 4-mL overnight cultures by use of the Wizard Plus MiniPrep kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The ground material was used for genomic DNA extraction with the RSC Plant DNA Kit (Promega, Madison, WI, USA) using the Maxwell® RSC device according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ATP levels in conditioned media and serum were measured by RealTime-Glo Extracellular ATP Assay kit (Promega, Madison, WI).
-
bioRxiv - Cell Biology 2024Quote: ... and equal amounts of RNA per sample were transcribed into cDNA using the GoScriptTM Reverse Transcription Kit (Promega #A5000). Quantitative PCR (qPCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... tumoral area was macrodissected prior DNA extraction using Maxwell 16 FFPE LEV DNA Purification Kit (Promega, Madison, WI, USA). DNA from the 60 non-CCHD carotid bodies were previously extracted and passed internal quality control at the VHIO’s laboratory before sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... Twenty-four hours after transfection cells were harvested for luciferase assay using the Dual-Glo Reporter Assay Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... cell supernatants were harvested for RNA extraction with a Maxwell RSV Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI). Then ...
-
bioRxiv - Biophysics 2021Quote: HEK293T cells were collected and pelleted 72 hr post-transfection for genomic DNA extraction using the Wizard Genomic DNA Purification Kit (Promega). The target locus was PCR-amplified using AccuPrime Pfx high-fidelity DNA polymerase (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting libraries were checked for their quality using the High-sensitivity DNA chip using the Agilent 2100 Bioanalyzer (Waldbroon, Germany) and quantified using the QuantiFluor One dsDNA kit (Promega). Paired-end (2x300bp ...