Labshake search
Citations for Promega :
251 - 300 of 4929 citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... caspase 3/7 activity was measured using Apo-ONE® Homogenous Caspase 3/7 Assay (Promega). VSMC were grown on a 96 well plate and 50 µl of the reagent was added to 50 µl of medium in each well ...
-
bioRxiv - Cancer Biology 2023Quote: ... caspase 3/7 activity was measured using Caspase-Glo® 3/7 Assay System-(Promega, G8091) per manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... after which the plate is read for luciferase signal using GloMax Explorer Plate Reader (Promega). For each ratio (CAR-T ...
-
bioRxiv - Microbiology 2023Quote: ... The plate was read at a wavelength of 450nm with a Glomax plate reader (Promega). Toxin concentration in each sample was calculated using the standard curve and normalized by the optical density of the culture ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pAdVAntage (3 µg, E1711, Promega) using Lipofectamine 2000 Transfection Reagent (11668019 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and pAdVAntage (3 µg, E1711, Promega) using Lipofectamine 2000 Transfection Reagent (11668019 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 mM of MgCl2 (Promega, USA), 10 pM of each primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... and Caspase 3/7 assay (Promega), respectively ...
-
bioRxiv - Cell Biology 2022Quote: ... Caspase 3/7 activity (Promega, G8091), and Nucgreen Dead 488 staining (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pAdVAntage (3 μg, E1711, Promega) using Lipofectamine 2000 Transfection Reagent (11668019 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase-Glo 3/7 assay (Promega) was used according to the manufacturer’s manual ...
-
bioRxiv - Biophysics 2023Quote: ... and 3 µM CA-JF646 (Promega). Cells were then imaged at room temperature with a 60x objective (N.A ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 3 ng/μl trypsin (Promega) were added to the dried pieces and incubated on ice for at least 40 min ...
-
bioRxiv - Biochemistry 2022Quote: Intracellular glutamate was measured in chondrocytes in 96 well plate format utilizing Glutamate-Glo assay kit (J7021, Promega, Madison, WI USA). Luminescence was measured on microplate reader ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Luciferase activity was assayed in an Omega luminescence plate-reader (Fluostar) with four different gains following the instructions of the Nano Dual-Luciferase® Reporter kit (Promega). A further correction for luminescence bleed-through was applied using the software developed by Mauri et al ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... H12) of each 96 well plate were pooled prior to DNA extraction using Wizard Genomic DNA purification kit (Promega, Madison, Wisconsin). The P0 region including the beginning of galK was amplified for 25 PCR cycles using primers deep_seq_Fw and deep_seq_Rv carrying 5’ adaptors for Illumina sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... venezuelae macrocolonies that were grown for 30 h at 30°C on MYM agar were pooled and resuspended in 200 µl ice-cold stop solution (5% phenol (pH 4.3) in 98% ethanol) and RNA was isolated using the SV Total RNA Isolation Kit (Promega). After elution ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... PAO1-WT and few colonies that grew in 3 mM 22D-chelated condition were isolated and gDNA extracted using Wizard® Genomic DNA Purification Kit (Promega, USA) for use in whole genome sequencing ...
-
bioRxiv - Biochemistry 2021Quote: The activity of Caspase 3/7 was determined using the Caspase-Glo® 3/7 Assay (Promega). Upon incubation of the cells with the different treatment regimens ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cleavage of Caspase 3 and 7 was quantified by using Caspase-Glo 3/7 Assay System (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... caspase-3/7 activity was determined using the Apo-ONE® homogeneous caspase-3/7 assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was measured using the Caspase-Glo® 3/7 Assay System (G8090, Promega) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Caspase 3/7 activity was then quantified using the Apo-One Homogenous Caspase-3/7 assay (Promega).
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Cell Biology 2023Quote: ... was added to the wells and the plate was introduced into the GloMax plate reader (Promega). The first 7 minutes absorbance was measured at 560nm every minute for baseline pH calibration ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... on the GloMax plate reader (Promega). Each oligo was tested using two biological replicates on different days and each biological replicate consisted of three technical replicates ...
-
bioRxiv - Microbiology 2020Quote: ... and a Glowmax plate luminometer (Promega).
-
bioRxiv - Immunology 2021Quote: ... using a Glomax plate reader (Promega). Measurements were performed in duplicate and used to calculate 50% inhibitory concentrations (IC50 ...
-
bioRxiv - Neuroscience 2023Quote: ... obtained using GLoMax plate reader (Promega), was interpolated against the standard curve to calculate the neurotrophin concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... abd a GloMax plate-reader (Promega). Samples were prepared by boillling with 2x Laemmli sample buffer (BioRad ...
-
bioRxiv - Molecular Biology 2023Quote: ... and a GloMax+ plate reader (Promega).
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... deep 96 well plate (V6771, Promega) in darkness in a 28°C incubator for 24 hours ...
-
bioRxiv - Genetics 2024Quote: ... and Glomax Discover plate reader (Promega). The measurement was performed every 24 hours starting from the day after seeding (24h ...
-
bioRxiv - Neuroscience 2024Quote: ... with a GloMax plate reader (Promega). Firefly luciferase activities were normalized based on the Renilla luciferase activity in each well.
-
bioRxiv - Bioengineering 2024Quote: ... or a GloMax Plate Reader (Promega). The concentrations of the samples were determined by extrapolation from a standard curve made with a four-parameter nonlinear regression model in Prism.
-
bioRxiv - Bioengineering 2024Quote: ... or a GloMax Plate Reader (Promega). Percent infection was calculated using background-subtracted signals from wells containing virus only as a 100% infection reference ...
-
bioRxiv - Neuroscience 2020Quote: The toxicity of PX was investigated on monolayers of BLEC seeded on 96 well plates or on inserts luminal side in co-culture experiments using the commercially available Cytotoxicity Detection Kit (Promega, United States). An aliquot of 25 μl medium was taken to quantify the lactate dehydrogenase (LDH ...
-
bioRxiv - Synthetic Biology 2023Quote: ... lysed with 1X Passive Lysis Buffer then analysed using the Dual-Luciferase Assay kit on a GloMax multi+ plate reader (Promega, Southampton, UK).
-
bioRxiv - Immunology 2022Quote: The genomic DNA of the 5 assessed M strains were isolated and purified using the Wizard Genomic DNA Purification Kit (Promega). The growing of strains ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Immunology 2021Quote: ... Wells were then washed 5 times with wash buffer and the remaining bound cells were detected with the CellTiterGlo kit (Promega) as per the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2019Quote: High-molecular weight genomic DNA of bacteria was isolated from 5 mL overnight cultures using the Wizard genomic DNA isolation kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested day 1 and day 5 post-infection using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (2000 g x 5 min) and subjected to genomic DNA (gDNA) extraction using the Wizard Genomic DNA Purification kit (Promega), according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with or without 50 μM adenosine 5′-triphosphate (ATP) at 30 °C for 30 minutes followed by kinase assays using ADP-Glo Kinase Assay kit (Promega). Data were analyzed using GraphPad Prism 9 ...
-
bioRxiv - Microbiology 2023Quote: ... The inoculum was added to HEK293T cells and incubated at 37 ° C with 5% CO2 and the luciferase signal was with analyzed using luciferase assay kit (Promega).