Labshake search
Citations for Promega :
101 - 150 of 4929 citations for Pregnanediol 3 Glucuronide PDG ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... membranes were incubated in a 0.165 mg/ml BCIP (5-bromo-4-chloro-3-indolyl phosphate, Promega)/ 0.33 mg/ml NBT (p-nitroblue tetrazolium chloride ...
-
bioRxiv - Molecular Biology 2022Quote: ... the HIV 5’ LTR from the pNL4-3 isolate (Genbank AF324493) was cloned into pGL3-Basic (Promega) via Gibson assembly (NEB 2X HiFi ...
-
bioRxiv - Cancer Biology 2022Quote: ... Apo-one Homogeneous Caspase-3/7 Assay kit was performed according to the manufacturer’s protocol to calculate caspase 3/7 activity (Promega Corporation, Madison, WI). Additionally ...
-
bioRxiv - Cell Biology 2022Quote: ... Baseline fluorescence was measured in an ELISA reader (Promega) following an incubation of 30 min at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Neuroscience 2019Quote: ... caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega). Cell viability was detected using the CytoPainter Live Cell Labeling Kit (Abcam ...
-
bioRxiv - Biochemistry 2020Quote: ... the Caspase-Glo 3/7 reagent (G8092/G8093 kit; Promega, Madison WI, USA) was prepared at room-temperature according to the manufacturer′s specifications ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were tested for mycoplasma every 3 months with the Mycoalert kit (Promega), and identity was confirmed by STR profiling (DFCI molecular diagnostics laboratory) ...
-
bioRxiv - Neuroscience 2023Quote: ... Caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... 50 µL of the cell and 1xPBS mixture were transferred into a 96-well plate bottom white plate (Costar Cat#3922) and lysis buffer from Nano-Glo Luciferase Assay Kit (Promega Cat#N1120) was added directly to the plates following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... After the addition of 5 mM ATP the reaction was taken to a plate reader (Promega GloMax Navigator) and the luminescence collected for approximately 30 minutes ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... CytoTox-OneTM homogeneous membrane integrity assay kit and Caspase-Glo® 3/7 assay system kit were from Promega, WI ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Cell Biology 2020Quote: ... Caspase 3/7 activity was measured using an Apolive-Glo kit (Promega, Madison, WI) and measured using a SpectraMax M5 (Molecular Devices ...
-
bioRxiv - Cancer Biology 2023Quote: Apoptosis was assessed using the luminescence-base Caspase-Glo 3/7 assay kit (Promega) and defined by at least a 1.5-fold increase in signal activation concerning controls ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... drugs were added to plates in triplicate and incubated for 3 days before being developed by adding CellTiterGlo (Promega, Madison, WI) per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: HEK293T cells were transfected in a 6-well plate with 1 μg ADGRG6 DNA and 3 μL transfection reagent Fugene 6 (Promega, PRE2693) at 60-70% confluency and incubated for 48 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plates were incubated for 72hr at 37°C with 5% CO2 and then measured by CellTiter-Glo assay (Promega). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed 5 times with wash buffer (PBS with 1% BSA (Capricorn Scientific) and 0.05% Tween-20 (Promega)) ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Bioengineering 2020Quote: The therapeutic effect of free taxane (pro)drugs and LNP formulations was determined by the [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) or the resazurin-based PrestoBlue assay (ThermoFisher) ...
-
bioRxiv - Microbiology 2019Quote: ... The genes of interest along with ∼700 bp of 3’ and 5’ flanking DNA were amplified and cloned into the vector pGEM-T Easy (Promega) to create pGEMlpg0277 ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Molecular Biology 2021Quote: ... A total of 24 clones (4 holobionts x 3 replicates x 24 clones = three 96-well plates) from each amplicon were amplified directly with GoTaq polymerase (Promega, Lyon France) in a 25 μL reaction volume using the following PCR parameters ...
-
bioRxiv - Neuroscience 2020Quote: Caspase activity was measured using a chemiluminescent assay kit (Promega Caspase-Glo® 3/7) in 96-well format using an Analyst HT plate reader (Molecular Devices ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activation was measured using the CaspaseGlo 3/7 Assay Kit (Promega, Madison, WI, USA) according to manufacturer’s instructions for the indicated time point presented in the figure legend ...
-
bioRxiv - Cell Biology 2023Quote: ... Apoptosis activities were detected using substrate from the Caspase-3 Glo Apoptosis kit (Promega, WI).
-
bioRxiv - Microbiology 2022Quote: ... was added to the plate and incubated at room temperature for 5 min before measuring luminescence on a GloMax 96 luminometer (Promega).
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Luciferase and Renilla activities were measured by Biotek Synergy 2 plate reader (Winooski, VT) using the Dual-luciferase assay kit (Promega, Madison, WI).
-
bioRxiv - Cancer Biology 2020Quote: ... the full-length fragment of human PFKFB3-5 was amplified with primers PFKFB3-5 reverse and PFKFB3-5 forward and subcloned into the plasmid pGEM-T using the T/A Cloning Kit (Promega, Mannheim, Germany). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...