Labshake search
Citations for Promega :
251 - 300 of 4024 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 20 pmols of folded pre-tRNA substrate was incubated with a final concentration of 5 U ml−1 RNasin plus inhibitor (Promega), 5 mM ATP and 8 pmols of TSEN complex in a final reaction volume of 20 μl for 1 h at 30 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples were diluted with ddH2O 1:5 and proteins were digested for 20 h at 37°C using trypsin (Trypsin Gold, Promega) at an enzyme/protein ratio of 1:50 ...
-
bioRxiv - Microbiology 2020Quote: ... The plates were washed with PBS-T 5 times and a 1:5000 dilution of HRP-conjugated goat anti-rabbit IgG antibody (Promega) was added for 45 min at 37 □ ...
-
bioRxiv - Cell Biology 2022Quote: Halo-MDC1 deletion mutants were expressed transiently by transfecting ∼ 5 × 105 cells with 1 µg of plasmid DNA using FuGene 6 (Promega). For genome editing ...
-
bioRxiv - Microbiology 2022Quote: ... between 0.5 to 1 µg of total RNA was reverse transcribed into cDNA using an ImProm II Reverse Transcriptase kit (Promega). Equal amounts of cDNA were quantified by RT-qPCR using the IQ SYBR green Supermix (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL of a solution that is 1 mM in each of the 20 essential amino acids (Promega, No. L4461); 20 μl of Promega S30 Premix without Amino Acids (No ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested day 1 and day 5 post-infection using a CellTiter-Glo Luminescent Cell Viability Assay Kit (Promega) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Cell Biology 2024Quote: ... An amount corresponding to 5 % of the pull-down volume was saved for Western blot analyses and 1 µg of trypsin gold (Promega) was then added to the beads for 16 h at room temperature in a thermomixer at 600 RPM ...
-
bioRxiv - Biochemistry 2024Quote: ... then resuspended in 1 gel volume of 25 mM ABC containing 5 ng/µL of digestion grade trypsin (Promega, V5111) and incubated at 37°C for 16 hours for a full digestion or for 15 minutes for a partial digestion ...
-
bioRxiv - Microbiology 2024Quote: ... After three rounds of washing in PBST the following Horseradish peroxidase-conjugated secondary antibodies were diluted in 5% milk-PBST and used with at a 1:10000 dilution anti-rabbit (W4018, Promega), 1:5000 anti-mouse (W402B ...
-
bioRxiv - Biochemistry 2024Quote: ... and wild-type or mutant βarr1 with a C-terminal HA tag with a 1:5 DNA:FuGENE®6 (Promega) ratio according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM iodoacetamide (IAA) and proteins were eluted by digestion with 5 µg/ml trypsin (Promega). Eluted proteins were fully digested overnight ...
-
bioRxiv - Plant Biology 2024Quote: ... genes were cloned in pFN19A (N-terminal HaloTag®) T7 SP6 Flexi® vector (Promega, USA; discontinued) by Gibson assembly (Gibson et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 units GoTaq DNA polymerase (Promega) and water to 50μl ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μL ADP-Glo reagent (Promega) was added to each reaction mixture and incubated for 40 min at 25°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5 µL RNasin Plus (Promega) per sample to 800 µL lysate and 1.5-2 hours of rotation at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM HaloTag-TMR ligand (Promega), Ready-Lyse Lysozyme (47 U/μl ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μl of CellTiter-Blue (Promega) was added and cells were incubated for 90 minutes at 37°C before measuring fluorescence using an EnVision plate reader (PerkinElmer) ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of CTG reagent (Promega G7571 ...
-
bioRxiv - Immunology 2023Quote: ... 5 ng of pRL-TK (Promega), and 5 ng of pEF-Slc46 expression plasmid using GeneJuice (Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg/mL proteinase K (Promega)) and incubated overnight at 50°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The phRL-TK (5 ng) (Promega), expressing the Renilla luciferase gene under the control of the HSV-TK promoter ...
-
bioRxiv - Immunology 2024Quote: ... 0.25 µL of 5% digitonin (Promega); 8.75 µL of nuclease-free water ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 ng/ul Trypsin Gold (Promega). Incubation lasted 30 minutes at 30 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 mg/mL 50 μL aliquots of cleared lysates were incubated with 2 μL of indicated trypsin concentration (Promega) at 4°C for 15 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were lysed after 72 h (2+1 DIV for differentiations) using the Dual Luciferase Reporter kit (Promega, E1960) and luciferase activity was measured using a Victor3 (Perkin Elmer ...
-
bioRxiv - Immunology 2021Quote: ... SIV pseudovirus Env construct was cotransfected with env-deficient backbone plasmid (pSG3ΔEnv) in a 1:2 ratio with transfection reagent FuGENE 6 (Promega) in HEK 293T cells according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... A partial trypsin digestion was performed to release proteins from the beads by using 80 μL of 2 M urea/50 mM Tris containing 1 mM DTT and 0.4 μg trypsin (Mass Spectrometry Grade, Promega) for 1 h at 25 C ...
-
Blunted Fas signaling favors RIPK1-driven neutrophil necroptosis in critically ill COVID-19 patientsbioRxiv - Immunology 2021Quote: Supernatants were incubated 1:2 with the substrate solution of the CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega) for 30 min in the dark in a 96-well plate (Greiner) ...
-
bioRxiv - Biochemistry 2020Quote: ... before being washed and resuspended in 2 M urea and trypsinized overnight with 0.5 μg μl−1 sequencing grade trypsin (Promega). Tryptic peptides were eluted off ...
-
bioRxiv - Molecular Biology 2022Quote: ... Semiquantitative PCR reactions were carried out with 1–2 μL of cDNA and 0.2 μL of GoTaq DNA Polymerase (Promega) in a total reaction volume of 30 μL according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... to a final urea concentration of 2 M for overnight Trypsin/Lys-C digestion at 35°C (1:100 protease:substrate ratio, Mass Spectrometry grade, Promega Corporation ...
-
bioRxiv - Immunology 2023Quote: Transient transfection was performed using 1 or 2 µg plasmid DNA and 3.5 or 7 µl FuGENE HD transfection reagent (Promega) per 5x 105 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... were transfected 2 days after plating with 1 μg of total DNA with FuGENE 6 transfection reagent (E2691; Promega) at a ratio 1:3.
-
bioRxiv - Neuroscience 2022Quote: ... HEK cells were transfected with the targeting plasmid and two helper plasmids (psPAX2 and pMD2.G) at a 2:1.5:1 molar ratio using ProFection (Promega). Two to three days later ...
-
bioRxiv - Cell Biology 2022Quote: ... The gel pieces were rehydrated in trypsin solution (50 mM ABC pH 8.0, 1 or 2 µg trypsin per sample for proteome or BioID respectively, Promega) overnight at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... Then the beads were incubated with 80 μL of 2 M urea in 50 mM Tris-HCL containing 1 mM DTT and 0.4 μg trypsin (Promega) at 25 °C for 1 hour while shaking at 1,000 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... Beads were resuspended in 500 µL of 100 mM Tris-HCl pH 8.0 containing 2 mM CaCl2 and digested at 37 °C for 1 h with 0.2 μg of trypsin/LysC (#V5073 Promega). The samples were then loaded onto homemade SepPak C18 Tips packed by stacking three AttractSPE disk (#SPE-Disks-Bio-C18–100.47.20 ...
-
bioRxiv - Cell Biology 2023Quote: ... various concentrations of the compounds were mixed with 1 - 2 nM sensor and 1,000-fold diluted furimazine (Nano-Glo Luciferase Assay Substrate, Promega) in 100 μL of buffer (50 mM HEPES ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells were pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells are pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 5’ UTR of mouse 5’-tRFCys targets or non-target Gapdh were cloned into psiCHECK2 (Promega). Synthetic 5’-tRF-Cys antisense or a scrambled control sequence embedded in the tough decoy backbone (Haraguchi et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... gDNA was amplified using primers 5’-AGTCCCTTCCTTGTCACTTAGT-3’ and 5’-ATCTCACAAGAAAGCGAAATCC-3’ and GoTaq DNA Polymerase (Promega), then digested using EcoRV (New England Biosciences) ...