Labshake search
Citations for Promega :
451 - 500 of 4024 citations for N 5 Trimethoxysilyl 2 Aza 1 Oxopentyl Caprolactam since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng renilla control reporter vector (Promega), mock luciferase ...
-
bioRxiv - Genomics 2024Quote: ... lysed by a 5× reporter lysis buffer (Promega) and incubated overnight at −20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected according to manufacturer instruction with a transfection mix containing a ratio of 1 µg of plasmid for 2 µl FuGene HD transfection reagent (Promega, REF E2311) diluted in DMEM without FCS ...
-
bioRxiv - Molecular Biology 2021Quote: Melan-ink4a melanocytes were seeded on glass coverslips in 24-well plates at 3×104 cells/well and the day after were transfected with 1 μg of cDNA plasmid (Table S2) mixed with 2 μl of FuGENE6 (Promega, Madison, Wisconsin) in 500 μl Opti-MEM ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted to 2 M urea with 50 mM HEPES (pH 8.5) and proteolyzed with trypsin (Promega, 1:50 w/w) at room temperature overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... Columns were washed with 90% methanol/100 mM TEAB 10 times prior to on-column digestion with 1 ug Trypsin/Lys-C in 50 mM TEAB (47° C, 2 hours; Cat. #V5073, Promega, Madison, WI). The resulting peptides were eluted with sequential washes of 50 mM TEAB ...
-
bioRxiv - Neuroscience 2022Quote: ... followed by sonication in the Bioruptor Plus sonication system and incubation with 1 μg of LysC and 2 μg of Trypsin (Promega Cat#V511A) at 37°C for overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... Japan) at 37 C for 2 h before digestion overnight with 1 ug Trypsin/Lys-C mix (V5071, Promega, Madison, WI, USA) at 37 C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Secondary HRP-conjugated antibodies were added at a dilution of 1:10,000 in 5% milk in TBST and incubated for 60 minutes at room temperature (Anti-Mouse: Promega #W402B; Anti-Rabbit: Promega #W401B). The Pierce SuperSignal West Pico PLUS chemiluminescent substrate (Thermo Scientific #34577 ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl ViaFect™ (Promega, Madison, WI) and 40 µl Gibco Opti-MEM reduced serum media (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg/ml proteinase K (Promega, v3021)) at 37 °C overnight followed by addition of 10 μl of 3M potassium acetate and incubation at room temperature for 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL RNasin RNase inhibitor (Promega). The transcription reaction was incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg Sequencing Grade Trypsin (Promega). The beads were shaken overnight at 37 °C and pelleted by centrifugation (1,400 rcf ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 µg of sequencing grade trypsin (Promega) was then added to the samples and they were digested overnight at 37°C ...
-
bioRxiv - Microbiology 2022Quote: The psiCHECK-2 control vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3′ UTR vector were described before26 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL dNTP (Promega U151B, 2.5 mM), 1.5 µL MgCl2 (25 mM) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 0.05 μg LgBiT-β-arrestin-2 (Promega) plus 0.9 µg pcDNA3.1 for 24 hours ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μL of luciferin reagent (Promega BrightGlo) was added and luciferase activity detected (Perkin Elmer Envision) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 or 4 (Promega Madison, WI, USA) (62) ...
-
bioRxiv - Bioengineering 2022Quote: ... 2 U/µL RNasin Ribonuclease Inhibitor (Promega), 1.2 µM PrimeTime primers ...
-
Optimization and deoptimization of codons in SARS-CoV-2 and the implications for vaccine developmentbioRxiv - Evolutionary Biology 2022Quote: Dual-luciferase assay (psiCHECK-2 vector, Promega) was selected to analyze the effects of the viral mutation on protein synthesis ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with 2 µg Trypsin (Promega) overnight at 37 °C shaking at 1200 RPM on a thermomixer ...