Labshake search
Citations for Promega :
2851 - 2900 of 4516 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... 30 μL of CellTiter Glo (Promega, diluted 1:6), was added to each well and luminescence was measured with an Envision plate reader ...
-
bioRxiv - Neuroscience 2023Quote: ... and goat anti-mouse IgG (1:5,000; W4011, Promega) antibodies ...
-
bioRxiv - Microbiology 2023Quote: ... using SYBR Green GoTaq 1-Step RT-qPCR (Promega) with the SARS-CoV-2 CDC N3 primers (F – GGGAGCCTTGAATACACCAAAA ...
-
bioRxiv - Bioengineering 2023Quote: ... 1 μL random primers (50 ng/μL, Promega, C1181), 2 μL 0.1 M DTT ...
-
bioRxiv - Systems Biology 2024Quote: ... Then 1 µg of sequencing grade modified trypsin (Promega) was added to the samples and incubated for 16 h at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Immunology 2023Quote: ... in a 1.5:1 ratio with FuGene (#E2311, Promega). One day post transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were dyed with 1 – 10 pM JF549 (Promega) and 50 nM Hoechst 33342 for an hour ...
-
bioRxiv - Neuroscience 2024Quote: ... then digested with trypsin (Promega, 1:50 w/w) overnight at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µL of HiBit buffer (LgBit 1:200, Promega, N112A ...
-
bioRxiv - Neuroscience 2024Quote: ... rabbit anti-GFAP (1:1000; Promega, Cat. No. G560A), rabbit anti-GPX4 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... and RNasin® Ribonuclease Inhibitor (#N2615, Promega; 1:1000)) ...
-
bioRxiv - Microbiology 2024Quote: ... leaves were sprayed with 1□mM luciferin (Promega, E1603) and 0.02 % (v/v ...
-
bioRxiv - Developmental Biology 2021Quote: ... Limb fragments were immediately transferred in 1.5 ml LowBind tubes with 500 ul of ice-cold lysis buffer (Reliaprep RNA Tissue MiniPrep System, Promega #Z6111), vortexed ...
-
bioRxiv - Biochemistry 2022Quote: HeLa and HEK293T cells were seeded on 18 mm glass coverslips at a density of 3×105 cells/mL and were transfected with FuGENE 6 (Promega) transfection reagent 24 h later ...
-
bioRxiv - Neuroscience 2021Quote: IP and pull-down probes of DG NSCs were subjected to on-bead digestion (Hubner et al., 2010) by trypsin (5 µg/ml, Promega) in 1.6 M Urea / 0.1 M Ammonium bicarbonate buffer at 27 C for 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: Viral RNA was extracted from 0.2 mL of cobas PCR Media using Maxwell® 16 instrument (Promega, Madison, WI, USA) for final elution in 30μL ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mL of cultures grown to early stationary phase and genomic DNA extracted with a Wizard Genomic DNA Purification Kit (Promega). Outside-in colony PCR of a subset of hpn genes was performed with PrimeSTAR DNA polymerase (TaKaRa ...
-
Neuronal L-Type Calcium Channel Signaling to the Nucleus Requires a Novel CaMKIIα-Shank3 InteractionbioRxiv - Neuroscience 2019Quote: ... Media was then removed and cells were incubated in serum-free DMEM containing either 0.49% dimethyl sulfoxide (Pierce) or a differentiation medium (serum-free DMEM supplemented with 10 ng/ml fibroblast growth factor (Promega), 240 μM isobutylmethylxanthine (Sigma) ...
-
bioRxiv - Biochemistry 2019Quote: ... Media was replaced at 24 h post-transfection and cells were lysed at 48 h post-transfection using 200 ml passive lysis buffer (Promega) followed by freezing at −80 °C ...
-
bioRxiv - Biochemistry 2019Quote: ... Media was replaced at 24 h post-transfection and cells were lysed at 48 h post-transfection using 200 ml passive lysis buffer (Promega). FLuc and RLuc activity was measured using a dual-luciferase reporter assay system (Promega) ...
-
bioRxiv - Bioengineering 2020Quote: ... Reverse transcription into cDNA was done from 3 μg of RNA by using 500 μg/mL random hexamers (Promega, Switzerland) and 0.5 μL of 200 UI/mL SuperScript III reverse transcriptase (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... before treatment without or with OSM (10 ng/ml, 45 min) and RNA extraction (ReliaPrep RNA Cell Miniprep System, Promega). cDNA was generated using oligo(dT)20 primer (GoScript Reverse Transcription System ...
-
bioRxiv - Microbiology 2020Quote: ... the target cells were resuspended at 3×105/mL in prewarmed culture medium that contains EnduRen live cell substrate (Promega) at a final concentration of 17 ng/ml and incubated for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Proteins on beads were digested overnight at 37°C by sequencing grade trypsin (12.5 μg/ml; Promega Madison, Wi, USA) in 20 μl of NH4HCO3 25 mmol/l ...
-
bioRxiv - Neuroscience 2020Quote: ... Whole mount in situ hybridization was performed as previously described 55 with the following modifications: 5 dpf larvae were permeabilized by digesting with Proteinase K (10ug/ml, Promega) for 2 hours ...
-
bioRxiv - Microbiology 2021Quote: ... air-dried and treated by 10 mkl of 12 mg/mL solution of trypsin (Trypsin Gold, Mass Spectrometry Grade, Promega) in 50 mM ammonium bicarbonate for 15 h at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and Bone Morphogenetic Protein 4 (BMP4, 10 ng/ml, Bio-Techne) plus phosphoinositide 3-kinase inhibitor Ly294002 (10 µM, Promega). After 42 h incubation at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Five ml of BHI broth containing 10 μg/ml tetracycline was inoculated with a single colony and genomic DNA was extracted (Wizard DNA extraction kit, Promega). Genomic DNA was sequenced by paired-end joining Illumina (Biomics Platform of the Institut Pasteur ...
-
bioRxiv - Cancer Biology 2021Quote: ... 293T cells were transfected with 8xTEAD synthetic YAP/TAZ-responsive promoter-luciferase reporter and treated with BSA or recombinant TNC (5 µg/mL) for 48 h to measure YAP1 signaling activity using Dual-luciferase Reporter Assay Kit (Promega).
-
bioRxiv - Microbiology 2019Quote: ... alkylated with 55 mM iodoacetamide (IAA) and incubated with 20 µl of 25 mM NH4HCO3 containing 12.5 µg/ml sequencing-grade trypsin (Promega, France) overnight at 37°C ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were grown in 5 mL LB medium overnight and plasmid DNA was isolated using the PureYield Plasmid Miniprep System (Promega). The plasmids were further tested by a restriction enzyme digestion analysis ...
-
bioRxiv - Microbiology 2021Quote: ... culture supernatant was removed from each well and replaced with 0.3 ml of ONE-Glo luciferase reagent (Promega, Madison, WI). The plates were shaken at 400 rpm for 10 min at room temperature ...
-
bioRxiv - Microbiology 2019Quote: High-molecular weight genomic DNA of bacteria was isolated from 5 mL overnight cultures using the Wizard genomic DNA isolation kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... The DNA pellet was resuspended in water with RNase A (10 µg/mL) for amplicon library preparation using GoTaq G2 Green Master Mix (Promega) and primers (Supplemental Table S1 ...
-
bioRxiv - Immunology 2020Quote: ... Single CD3-CD8-CD16- CD20+Ova-RBD-PE+RBD-AF647+ B cells were sorted into individual wells of a 96-well plates containing 4 μl of lysis buffer (0.5 X PBS, 10mM DTT, 3000 units/mL RNasin Ribonuclease Inhibitors (Promega, N2615) per well using a FACS Aria III (Becton Dickinson) ...
-
bioRxiv - Cancer Biology 2019Quote: ... all mice were intraperitoneally injected (150 mg/kg) with a 30 mg/ml solution of D-luciferin (Vivo Glo Luciferin, P1043, Promega) in PBS ...
-
bioRxiv - Biophysics 2022Quote: ... In vitro transcription reactions were incubated for 16 hours at 37 °C and then treated with 45 U/mL of RQ1 DNase (Promega) at 37 °C for 30 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... and then developed in the dark with fresh developing buffer supplemented with 225 μg/ml nitro blue tetrazolium (NBT) (Promega) and 175 μg/ml 5-bromo-4-chloro-3- indolyl-phosphate (BCIP ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and plasmids were extracted from individual cultures outgrown in LB/ampicillin (50 μg/mL) using the PURE Yield Plasmid Miniprep kit (Promega). Individual clones were screened and confirmed by Sanger sequencing at Macrogen-Europe B.V ...
-
bioRxiv - Molecular Biology 2024Quote: ... Powdered plant material (150 mg) was aliquoted and extracted with 1.25 mL hexadecyltrimethylammonium bromide (CTAB) buffer (MC1411, Promega, Madison, WI) containing proteinase K (ref 25530049 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The solution was then diluted to 4 mL with 50 mM ammonium bicarbonate and subjected to overnight digestion at 37°C with trypsin (Promega) using an enzyme to substrate ratio of 1:200 (w/w) ...
-
bioRxiv - Genomics 2023Quote: ... cells were incubated with DSPE liposomes at concentrations of 0-5mg/ml in DMEM containing the viability dye from the RealTime-Glo MT Cell Viability Assay (cat: G9712, Promega). After incubation with liposomes for 4h ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... Select colonies were then grown in 3 ml of LB with appropriate antibiotics and the plasmids were purified with PureYield Plasmid Miniprep System (Promega), performing restriction enzyme digests to verify that the plasmids had inserts.
-
bioRxiv - Cancer Biology 2023Quote: ... before drying further with a speed vac until the pieces were ‘dice-like bouncy.’ The protein samples were then incubated in digestion buffer [50 mM NH4HCO3 and 10 μg/mL Sequencing grade modified trypsin (Promega)] overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Biophysics 2024Quote: ... cells were washed once with 0.1 mL phosphate-buffered saline (PBS) and luciferase activity was measured with Dual Luciferase Reporter Assay System (Promega, E1910) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmid carrying cells were cultured overnight in DM250 supplemented with 50 μg/ml kanamycin and DNA isolated using a Wizard Genomic DNA Purification Kit (Promega). Amplification of target genes was carried out using a SYBR Green based qPCR mix consisting of Q5® High-Fidelity 2× Master Mix (NEB) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then treated overnight with 2000 U/mL of universal Type I IFN (PBL Bioscience) and lysed at 24 h post treatment using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...