Labshake search
Citations for Promega :
2651 - 2700 of 5642 citations for ssc mir 376a 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... was subjected to poly(A)+tract isolation kit (Promega). Poly(A)+ enriched RNA ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using the Reverse Transcription kit (Promega). Transcriptional levels of IFN-β ...
-
bioRxiv - Microbiology 2019Quote: ... followed by 350 μL RNA Dilution Buffer (Promega kit) were added to the cell suspensions ...
-
bioRxiv - Genomics 2019Quote: ... with a GoTaq® qPCR master mix kit (Promega). We used two technical replicates for each biological replicate ...
-
bioRxiv - Developmental Biology 2019Quote: ... Luminescence was measured following the kit protocol from Promega.
-
bioRxiv - Biochemistry 2020Quote: ... The pGEM-T Vector kit was purchased from Promega. Acrylamide/bisacrylamide (29:1 ...
-
bioRxiv - Microbiology 2019Quote: ATP was estimated using the BacTiter-Glo kit (Promega). For BDQ or INH treatments in MMA ...
-
bioRxiv - Cell Biology 2019Quote: ... and subsequently analyzed using the GoTaq Green kit (Promega) for analytical RT-PCRs with the primers listed in the Key Resources Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... Maxwell RSC DNA FFPE Kit (Promega Maxwell® RSC), PerkinElmer chemagic FFPE DNA kit (chemagic MSM 1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Wizard® Genomic DNA Purification Kit (Promega). The kit can be used for at least 100 isolations ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Maxwell 16 LEV Plant DNA Kit (Promega), with EcoR1 as the restriction enzyme for generating RAD-seq libraries ...
-
Cytoplasm localized ARID1B promotes oncogenesis in pancreatic cancer by activating RAF-ERK signalingbioRxiv - Cell Biology 2019Quote: Halo tag (Halo pulldown and labeling kit, Promega Corporations) and Streptavidin bead (GE Health care Bio-Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... The dual luciferase assay kit (Promega, Madison, WI, USA) and Glomax 96 Microplate Spectrophotometer (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Luciferase activity was measured by luciferase assay kit (Promega) using an LMaxII™ microplate luminometer (Molecular Devices) ...
-
bioRxiv - Cancer Biology 2021Quote: FGFR1 kinase enzyme system kit was purchased from Promega Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were authenticated using the GenePrint10 kit (Promega) and matching to their original profiles (ATCC) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Neutralization was measured with a luciferase assay kit (Promega) and plotted relative to the value for control wells.
-
bioRxiv - Plant Biology 2020Quote: ... or Maxwell® 16 LEV Plant RNA Kit (Promega). cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Maxwell 16 LEV Plant RNA Kit (Promega). RNA was quantified using a NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using MMLV reverse transcriptase kit (Promega) according to the manufacturers’ protocol with random primers (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard Kit (Promega), as stated above ...
-
bioRxiv - Microbiology 2021Quote: ... The Wizard genomic DNA purification kit (Promega, Madison, WI) was used for isolation of bacterial genomic DNA (gDNA) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Dual-luciferase reporter gene assay kit (Promega, Beijing, China) was used to measure activities of Luciferase ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Cell Titer Glo Luminescent Cell Viability Assay Kit (Promega) was used and subsequently performed after the BRET measurement ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Maxwell DNA LEV Blood Kit (Promega #AS1290) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a Wizard Genomic DNA Purification kit (Promega), and sent for Sanger sequencing (ACGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Triglyceride-Glo™ Assay kit (Cat#J3160, Promega) from Promega were used according to user’s manual ...
-
bioRxiv - Microbiology 2019Quote: ... coli S30 Extract system for Linear Templates kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: Wizard Genomic DNA purification kit (Promega, Madison, WI, USA) (Catalog NO. ...
-
bioRxiv - Immunology 2019Quote: ... and Caspase-Glo® 3/7 assay kit (Promega). A volume of 100 μL cells was placed in a 96-well plate ...
-
bioRxiv - Physiology 2019Quote: ... cDNA was synthesized using a Reverse Transcriptase kit (Promega). Quantitative real-time PCR was conducted using primer sets in Supplementary Table 1 and mRNA levels were analyzed in duplicate using SYBR green (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was determined using the CellTiterGlo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and purified with the Wizard SV Gel kit (Promega). The purified DNA was incubated with DpnI (New England BioLabs® ...
-
bioRxiv - Cancer Biology 2019Quote: ... Luciferase activities were measured with Luciferase assay kit (Promega) and were normalized with protein concentrations of samples.
-
bioRxiv - Genetics 2021Quote: ... using the Maxwell 16 Tissue DNA Purification kit (Promega). The ddRAD-seq library was constructed using all the genomic DNAs according to the method described in Peterson et al ...
-
bioRxiv - Plant Biology 2020Quote: ... The GoTaq qPCR Master Mix Kit (Promega Corporation, USA) was used for the gene expression profiling ...
-
bioRxiv - Microbiology 2021Quote: ... In vitro transcription reactions (Promega MegaScript T7 transcription kit) containing ∼400 ng of the purified PCR product ...
-
bioRxiv - Molecular Biology 2019Quote: ... Viability was determined using the CellTiter-Glo Kit (Promega) as per manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Luciferase expression was measured using the DualGlo Kit (Promega). Firefly luciferase signal was normalized to Renilla luciferase signal in each well ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the LDH CytoTox 96 kit from ProMega (Madison, WI), Urea Nitrogen Test from StanBio Laboratory (Boerne ...
-
bioRxiv - Molecular Biology 2019Quote: ... the plasmid was recovered using a miniprep kit (Promega), DpnI digested and transformed into MBM7070 indicator bacteria ...
-
bioRxiv - Microbiology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cAMP-Glo™ Assay kit (Promega, Cat. no. V1501) was used to measure cellular cAMP levels via GloMax® Discover Microplate Reader (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... with Maxwell® RSC simplyRNA Tissue Kit (AS134, Promega), following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lines were either fingerprinted (PowerPlex 1.2 Kit, Promega) or independently authenticated annually (ATCC ...