Labshake search
Citations for Promega :
201 - 250 of 2930 citations for Recombinant Human High Mobility Group Box 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Mice were tested individually in duplicates by stimulation with recombinant luciferase (13μg/ml, Promega, #E1701), SARS-CoV-2 spike protein (10μg/ml) ...
-
bioRxiv - Plant Biology 2023Quote: ... in the presence of 20 units of RNasin (Recombinant Ribonuclease Inhibitor, Cat. No. C2511; Promega) and dNTP mix at a final concentration of 0.5 mM of each dNTP (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... all the steps were done in the presence of RNase inhibitor (recombinant RNasein, Promega, N2511) diluted 1:4,000 for washing steps or 1:400 for incubation while staining and for buffers in the tubes containing the sorted cells followed by snap freeze and storage at –80°C.
-
bioRxiv - Biochemistry 2023Quote: ... 10 μg of the isolated recombinant bacmid and 5 μL Fugene HD transfection reagent (Promega) were diluted in 150 μL Sf-900™ III SFM ...
-
bioRxiv - Biochemistry 2020Quote: ... This strain (BL21DE3/pETDuet-1-6xhis-TEV-ftsE) was grown until OD600 of 0.5 and his-FtsE expression was induced with 0.3 mM IPTG (Promega) during 3 hours at 28°C ...
-
bioRxiv - Cell Biology 2020Quote: ... The complete Igκ-LaNt α31-Myc-His sequence was inserted into pGEM®-5Zf(+) vector (Promega, Madison, WI) using NheI and PmeI (New England Biolabs) ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Neuroscience 2023Quote: Intracellular ATP concentrations were measured in 38-45 independent wells per group from two unique culture preparations using the CellTiter-Glo 2.0 reagent (Promega Corp.; Madison, WI) as described (21) ...
-
bioRxiv - Cell Biology 2021Quote: ... bright field images of all plates were acquired with a high-throughput high-content imaging system (Operetta, Perkin-Elmer) and CellTiter-Glo luminescent cell viability assay (Promega, G7570) was performed ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.6 or 1 μg extracted RNA was converted into cDNA by reverse transcription using a High Capacity cDNA Reverse Transcription kit (Promega A3500) or a ReverTra Ace qPCR RT Master Mix (Toyobo) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Developmental Biology 2021Quote: ... as well as Tagged-BAF15 were synthesized using the TNT coupled reticulocyte lysate system according to the manual (Promega, L5020, USA). Briefly ...
-
bioRxiv - Developmental Biology 2022Quote: ... Recombinant C-terminally HA tagged Su(H) was produced using in vitro coupled transcription/translation (TNT with rabbit reticulocyte extracts; Promega Inc.) from DNA matrices generated by PCR using Su(H)-HA forward and reverse primers combined with the Su(H ...
-
bioRxiv - Developmental Biology 2020Quote: His-P150-CC1 (Courtois et al., 2012) was expressed in and purified from BL21(DE3)pLysS competent cells (Promega) as previously described (Courtois et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Restricted fragments to be cloned were ligated into the EcoRI and SacI restricted pBAD/His using T4 Ligase (Promega) before being heat shock-transformed into chemically competent E ...
-
bioRxiv - Biochemistry 2023Quote: ... Rat Gβ1 was fused with a His-tag at the N terminus and with a SmBiT subunit (peptide 86, Promega)34 after a 15-amino acid linker at its C terminus ...
-
bioRxiv - Biochemistry 2021Quote: To investigate enzymatic activity of recombinant PfGSK3 a commercial luminescence-based kinase assay (KinaseGlo Plus, Promega) was used as previously described (93) ...
-
bioRxiv - Molecular Biology 2021Quote: ... These recombinant plasmids were subsequently used to generate digoxigenin-labelled riboprobes using the Riboprobe System (Promega) with SP6 or T3 RNA polymerases and digoxigenin-labelled Uracil triphosphate (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant EbfC was expressed in Escherichia coli Rosetta II cells and purified using MagneHis Particles (Promega) as previously described (24 ...
-
bioRxiv - Microbiology 2021Quote: ... cells were lyzed and activities of luciferase for each group were detected by Dual-Luciferase® Reporter Assay System (Promega, Madison, WI, USA).
-
bioRxiv - Microbiology 2021Quote: LDH activity and percentage cell cytotoxicity in rabbit lungs (n=3 per group per time point) were determined using the LDH-Glow cytotoxicity kit as per the manufacturer’s instructions (Promega Corporation, Madison, WI, USA). Luminescence was recorded using a GloMax plate reader ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting proteins with carbamidomethyl groups on their cysteines were digested with 300 ng of sequencing-grade porcine trypsin (Promega, Fitchburg, MA, USA) and injected on an Easy-nanoLC-1000 system coupled to a Q-Exactive+ mass spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
Sequential dynein effectors regulate axonal autophagosome motility in a maturation-dependent pathwaybioRxiv - Cell Biology 2020Quote: COS-7 cells grown in 10 cm plates to 70–80% confluence expressing Halo-tagged K560 or KIF5B (KHC) were labeled with TMR-HaloTag ligand (Promega, Madison, WI) 18–24 h post-transfection then lysed in P12 buffer (as described above ...
-
bioRxiv - Biophysics 2023Quote: HeLa cells expressing each Halo-tagged chromatin remodeler were labeled with 5 nM Janelia Fluor® 549 (JF549) Halo-tag® ligand (GA1110, Promega) for 15 min at 37 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... and RPM1 CC-HA (1-156aa) were expressed in vitro using the TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega; Madison, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant proteins were purified with MagneGST™ Protein Purification System (www.promega.com/protocols/; Promega, Madison, WI, USA).
-
bioRxiv - Immunology 2023Quote: ... 10µg of recombinant C5AP and PRGA was trypsinized with 1µg of trypsin (Sequencing Grade Modified Trypsin, Promega) for 15 min at 37°C and the trypsin activity was inhibited by incubating at 100°C for 5 min ...