Labshake search
Citations for Promega :
1 - 50 of 2930 citations for Recombinant Human High Mobility Group Box 1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... His-tagged and GST-tagged recombinant proteins were purified using Promega MagneHis™ Ni-Particles (Promega Cat#V854A) and MagneGST™ Glutathione Particles (Promega Cat# V861A ...
-
bioRxiv - Biochemistry 2023Quote: ... recombinant GST-tagged MARK2 (Promega) was incubated with tau at 30 °C at 1:100 ratio of MARK2:tau in phosphorylation buffer (25 mM PIPES ...
-
bioRxiv - Molecular Biology 2022Quote: ... His-tagged proteins were purified using Ni-NTA resin (Promega); bound proteins were washed with binding buffer and eluted into elution buffer (4 M urea ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10.0 ng/ml recombinant human FGF (Promega) and 1.0 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2020Quote: ... The recombinant Halo-His-gene was expressed using a 30 μL TNT®SP6 High-Yield Wheat Germ Protein Expression System (Promega, USA, Catalog No L3261). Expression levels were determined by SDS-PAGE and western blot ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5ng ml-1 recombinant human fibroblast growth factor (rhFGF) (Promega, Cat#G5071, Madison, WI, USA), and 1% chicken embryonic extract (Seralab ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Genomics 2022Quote: ... 10 ng/mL recombinant human basic fibroblast growth factor (Promega), and 1 μM dexamethasone (Sigma-Aldrich) ...
-
bioRxiv - Biophysics 2021Quote: ... and 5 ng/ml recombinant human fibroblast growth factor (G5071, Promega).
-
bioRxiv - Neuroscience 2020Quote: ... after which beads were washed with 1X High Salt Wash Buffer(50mM Tris-HCl pH 7.4, 350mM NaCl, 1%NP-40 and 1 unit/ul Promega recombinant RNAsin). In the last wash ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5 ng/mL recombinant human basic fibroblast growth factor (bFGF, Promega) then centrifuged ...
-
bioRxiv - Microbiology 2019Quote: Cell-free translated His-VqmA was produced using the S30 T7 High-Yield Protein Expression System (Promega) according to the manufacturer’s protocol with the following amendments ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 mg of His-Tev-HaloTag-(3C)-human γ-TuNA was coupled to Halo Magne beads (Promega). Xenopus laevis egg extract was prepared by standard methods28 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10mM Ultrapure ATP and 0.7 μg of recombinant full-length human CDC7/DBF4 kinase (Promega, V5088). Reactions were incubated at 37 °C for 120 min and then terminated by freezing on dry ice before mass spectrometry.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cell surface levels of HiBiT-tagged human S1PR1 were monitored using a Nano Glo HiBiT Extracellular Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: Transient transfection of the dual NanoLuc and Halo-Tagged tagged BRD4Tandem plasmid (Promega) was performed as described previously52 ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were co-transfected with pcDNA5/FRT construct encoding haemagglutinin (HA)-tagged human CB1 receptor cDNA and pOG44 (Flp recombinase plasmid) using transfection reagent Fugene HD (Promega) as previously described for AtT-20 pituitary tumour cells [26] ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: Group two-choice assay: agarose (Promega) substrates were prepared as follows ...
-
bioRxiv - Molecular Biology 2023Quote: Electrophoretic Mobility Shift Assays were performed using proteins expressed in the TNT T7 Coupled Reticulocyte Lysate System (Promega, WI), according to the manufactureŕs recommendation ...
-
bioRxiv - Biophysics 2020Quote: ... to crosslink the silane groups and the amine group of halo-ligand (HaloTag amine O4 ligand, Promega) (Figure 3B) ...
-
bioRxiv - Cell Biology 2019Quote: ... the pGL4.34 vector plasmid containing the CArG box (SRF response element) was purchased from Promega (Cat.E1350). An empty vector was generated by removing the SRF response element ...
-
bioRxiv - Cancer Biology 2021Quote: ... short tandem repeat analysis verified the identity of mouse (Bioassay Methods Group, National Institute of Standards and Technology) and human (Promega GenePrint 10 System) cells.
-
bioRxiv - Microbiology 2021Quote: ... HA-tagged DDX1and HA-tagged TRIF were constructed by inserting indicated sequences into pCMV-HA (Promega), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... were transfected with FLAG-tagged Nlgn1 or GFP-tagged NGL-3 using Fugene6 (Promega, Cat #E2691). Transfected HEK293T cells were mechanically dissociated 24 hr after transfection and co-cultured with DIV10 cortical neurons prepared from C57BL/6J Sorcs1flox/flox mice for 16 hr.
-
bioRxiv - Microbiology 2022Quote: ... FLAG-tagged or HA-tagged protein was detected using a commercially available mouse monoclonal antibody (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease Inhibitor (1 uL/ml, Promega, Cat#N2511). The components of the high salt wash buffer are as follows ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was extracted using a phenol-based extraction protocol (Box et al., 2011) followed by DNAse (Promega) digestion at 37°C to remove the genomic DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... Janelia Fluor 646 tagged Halo ligand (Promega) was used at 200nM final concentration to label SINAPS-mRNA in cells prior to fixation/imaging.
-
bioRxiv - Molecular Biology 2023Quote: ... Recombinant (rTdT) enzyme (Promega). Cells were then incubated at 37 °C for 60 min ...
-
bioRxiv - Genomics 2023Quote: ... 1 ug human DNA (Promega, Madison, WI), 5 ug sheared salmon sperm DNA (Promega ...
-
bioRxiv - Immunology 2022Quote: ... Ectopic Flag-tagged Galectin 8 or HA-tagged LILRB4 plasmid were transfected into the Mc38/B16/HEK294 cells with Fugene (Promega). A blank vector control was applied ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease inhibitor (1 uL/ml; Promega, Madison, WI; Cat#N2511). These washes were followed by an additional wash with 500 μl each of both wash buffer and high salt wash buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease inhibitor (1 ul/ml; Promega, Madison, WI; Cat#N2511) with a mechanical homogenizer followed by addition of TURBO DNase (2 μl ...
-
bioRxiv - Molecular Biology 2023Quote: ... C-terminal large bit (LgBiT) tagged construct (Promega) which is transcribed under control of the HSV-TK promoter.
-
bioRxiv - Molecular Biology 2023Quote: ... N-terminal small bit (SmBiT) tagged construct (Promega), with the native HSV-TK promoter swapped out for a CMV promoter ...
-
bioRxiv - Cell Biology 2023Quote: ... the HaloTag-tagged SUV420H2 expression vector (FHC26822; Promega) was used as a template for PCR amplification of the target regions ...
-
bioRxiv - Cell Biology 2023Quote: The HaloTag-tagged KDM4D expression vector (FHC06842; Promega), the PB533-based H2B-Halo expression vector (Uchino et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... HCT116 cells expressing the auxin-responsive F-box protein Oryza sativa TIR1 (OsTIR1) under the control of a Tet promoter were transfected using FuGENE HD (Promega) with a CRISPR/Cas9 plasmid targeting nearby the 1st ATG codon of the RIF1 gene (5’-TCTCCAACAGCGGCGCGAGGggg-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Plant Biology 2022Quote: ... 1 μg of GST-tagged effector proteins and 2 μl of FluoroTect™ GreenLys tRNA (Promega, USA) were gently mixed with High-Yield Wheat Germ Master Mix ...
-
bioRxiv - Genetics 2019Quote: ... Purified recombinant luciferase protein (Promega) was used to generate a standard curve.
-
bioRxiv - Neuroscience 2020Quote: ... 1U/uL recombinant RNAsin(Promega), 10mM Na3VO4 ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant RNasin Ribonuclease inhibitor (Promega), and SuperScript II reverse transcriptase (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... and recombinant RNasin inhibitor (Promega). The transcripts for genes of interest were measured by real-time qPCR with a Lightcycler 480 II system (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... and ribonuclease (RNasin Recombinant, Promega) at concentrations of 1:1000 (sucrose buffer ...
-
bioRxiv - Neuroscience 2022Quote: RNA was extracted from sections of frozen mouse brain cerebrum representing each treatment group (n = 6 per group) using the Maxwell 16 LEV simplyRNA Tissue Kit (Promega, Ipswich, MA, USA; AS1270). RNA was extracted from cultured cells using the Maxwell 16 Cell LEV Total RNA Purification Kit (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...