Labshake search
Citations for Promega :
201 - 250 of 6271 citations for Mouse Lymphoid Enhancer Binding Factor 1 LEF1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... after isolating DNA from mouse tissue samples using a tissue DNA extraction kit (Maxwell® 16, Promega), the purified DNA was incubated and hydrolyzed enzymatically (EpiQuik ...
-
bioRxiv - Genomics 2022Quote: ... DNA extraction from mouse liver tissue was performed using the Maxwell 16 Tissue DNA Purification kit (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: Cellular and mouse serum cholesterol levels were measured using the Cholesterol/Cholesterol Ester-Glo Assay Kit (Promega). Cells were cultured in 96-well plates and then treated with the compounds at various concentrations ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-mouse HRP conjugate (W4021, 1:10,000) and Anti-Rabbit HRP Conjugate (W4011, 1:10,000) were purchased from Promega (Madison, WI). Anti-COPI antibody was a gift from Charles Barlowe (Dartmouth Univ ...
-
bioRxiv - Cell Biology 2020Quote: ... HRP Conjugate (W4011, 1:5000), and anti-Mouse IgG (H+L), HRP Conjugate (W4021, 1:5000) were purchased from Promega.
-
bioRxiv - Microbiology 2022Quote: ... caspase-1 activity was measured using the Caspase-Glo 1 Inflammasome Assay kit (Promega) per manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... After washing with 150 μL of binding buffer four times the samples were subjected to proteolytic digestion using 1.2 μg trypsin (sequencing grade, Promega) for 2h at 47°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Biophysics 2023Quote: ... The 12-230 kDa separation module was used for PCNA (CST, D3H8P, Rabbit, 1:100 dilution, #13110), b-Actin (CST, D6A8, Rabbit, 1:50 dilution, #8457S) and Halo (Promega, Mouse, 1:10 dilution, #G9211) detection ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by a 1:20,000 dilution of anti-mouse IgG HRP conjugated secondary antibody (Promega) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Neurite outgrowth was visualized by immunostaining with mouse anti-β III tubulin (1:1000; Promega) followed by incubation with Alexa 594-conjugated anti-mouse secondary antibodies (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... or secondary antibodies: anti-mouse IgG horseradish peroxidase (HRP) (Promega, Madison, WI, W402B, 1:10,000), anti-rabbit IgG HRP (Promega ...
-
bioRxiv - Immunology 2023Quote: ... followed by goat anti-mouse immunoglobulin conjugated to alkaline phosphatase (Promega S3721, dilution 1:7500). Focuses of infection were revealed using NBT/BCIP reagent (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-T-Cofilin 1:2000 (Bamburg lab, 1439 or Cell Signalling, 5175) and mouse anti-β3-tubulin 1:2000 (Promega, G7121) diluted in 1%BSA/PBS and incubated overnight at 4ºC ...
-
bioRxiv - Developmental Biology 2024Quote: ... The membranes were washed 3x 10 minutes in TBS-T before being incubated for 2 hours with the secondary anti-mouse-HRP- or anti-rabbit HRP antibody (1:5000, Promega anti-mouse, W4021; anti-rabbit W4011). The membranes were washed in TBS-T for 3x 10 minutes and developed with Western Lightning Plus-ECL reagent (Perkin Elmer NEL104) ...
-
bioRxiv - Cancer Biology 2024Quote: RNA from mouse tissue and from cell lines was extracted using the Maxwell RSC simplyRNA Cells Kit (Promega) on the Maxwell RSC instrument according to the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2019Quote: Caspase 1 activity was measured using commercially available kit (Caspase 1 Glo inflammasome assay, Promega). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: The minimal CYC1 promoter with seven tetracycline binding sites was amplified from the yeast Tet-Promoters collection35 with YG4866/YG4867 and cloned into pGEM-Teasy (Promega) to create pCB4695 ...
-
bioRxiv - Microbiology 2020Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega) resulting in the NoV-GII plasmids ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...
-
bioRxiv - Genomics 2020Quote: ... Viral RNA was extracted using the silica guanidinium isothiocyanate binding method (12) adapted for the ThermoFisher Kingfisher using paramagnetic silica particles (Magnesil, Promega).
-
bioRxiv - Developmental Biology 2019Quote: ... together with a TOPFLASH luciferase reporter construct containing synthetic Tcf-binding sites (Korinek et al., 1998) and a Renilla-luciferase reporter (Promega) for normalization ...
-
bioRxiv - Evolutionary Biology 2020Quote: To generate the pGl3-STK38-P luciferase reporter,1.2 kb of DNA upstream the STK38 TTS promoter region with ZNF611 binding motif was amplified by polymerase chain reaction (PCR) and cloned into the Firefly luciferase reporter plasmid pGL3-Basic (Promega) using KPN1 and XHO1 restriction sites.0.7 kb of DNA upstream the STK38 TTS promoter region without ZNF611 binding motif was cloned into pGL3-Basic using same restriction sites to generate the pGl3-STK38-ΔP luciferase reporter ...
-
bioRxiv - Microbiology 2022Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega), resulting in the NoV-GII plasmids ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Biochemistry 2024Quote: The 3′UTR fragment of the human PHF8 gene having native or mutated miR-22-3p or miR-1229-3p binding sites (Supplementary Figure S1) was cloned into the pmirGLO vector (Promega) cut with XbaI and DraI restriction enzymes (New England BioLabs) ...
-
bioRxiv - Molecular Biology 2021Quote: ... secondary antibody staining was performed for 1 h at room temperature using anti-rabbit HRP or anti-mouse HRP secondary antibodies (Promega, 1:10,000) in blocking buffer ...
-
bioRxiv - Biochemistry 2022Quote: ... secondary antibody staining was performed for 1 h at room temperature using antirabbit HRP or anti-mouse HRP secondary antibodies (Promega,1:10,000) in blocking buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... ELISA was performed on the homogenate using the BDNF Emax Immuno Assay Systems (Promega KK, Tokyo, Japan). The hippocampus (HPC ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were immediately read using a GloMax®-Multi Detection System microplate reader (Promega, Madison WI) at 450 nm absorbance.
-
bioRxiv - Molecular Biology 2021Quote: Primary antibodies and the dilutions used are as follows: anti-Halo (mouse, Promega G9211, 1:200); anti-Ezh2 (mouse ...
-
bioRxiv - Neuroscience 2020Quote: ... all cells were incubated in the following: mouse anti-βIII tubulin (1:1000; 2 hr; Promega) and goat anti-mouse Alexa 546 (1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... were secondary incubated with anti-mouse IgG (H+L) horseradish peroxidase coupled (1:3,000, W402b, Promega) and polyclonal anti-rabbit IgG (1:5000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used were: rabbit and mouse anti-βGal (1/1000; Promega and MP Biomedicals, respectiveley), rat anti-Ser (1/1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and then with 1:5000 of anti-rabbit (#W401B) or anti-mouse (#W402B) secondary antibodies (Promega).
-
bioRxiv - Genetics 2019Quote: ... As secondary antibodies horseradish peroxidase (HRP)-conjugated α-mouse or α-rabbit IgG (Promega, 1:4000) were used ...
-
bioRxiv - Developmental Biology 2021Quote: ... and mouse cyclin B1 were generated using the Riboprobe in vitro Transcription Systems kit according to the manufacturer’s protocol (Promega). Anti-BrdU antibodies were conjugated with protein A-sepharose beads overnight at 4C (GE Healthcare) ...
-
bioRxiv - Neuroscience 2019Quote: ... Genomic DNA was isolated from tail snip samples with Maxwell® Mouse Tail DNA Purification Kit (Promega, Madison, WI). Polymerase chain reaction (PCR ...
-
bioRxiv - Microbiology 2023Quote: The potential for M2e-specific antibodies to induce ADCC was evaluated using a mouse FcγRIV ADCC Reporter kit (Promega). In brief ...
-
bioRxiv - Immunology 2022Quote: Caspase-1 activity was quantified using a Caspase-Glo 1 Inflammasome Assay kit (Promega, Madison, WI). THP-1 cells were treated and harvested as described above ...
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2021Quote: A partial TWD1 fragment of 150 bp covering the TPR domain and a part of the calmodulin binding domains (aa 264-314) was PCR amplified and cloned into pGEM-T-Easy Vector (Promega Corp.) and verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (150 bp) one putative ETV2 binding site (Wei et al, 2010) were cloned into pGL3_Basic vector (Cat# E1751, Promega, Madison, WI). Primers Forward ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Molecular Biology 2019Quote: The 3’ UTR of target mRNAs spanning at least 500 bp around the predicted miRNA binding sites were cloned into the psi-CHECK2 vector (Promega, C8021) downstream of the Renilla luciferase gene (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: FOXM1 3’UTR region comprising of miRNA binding region was cloned into pmirGLO-Dual Luciferase miRNA target expression vector for miRNA luciferase reporter assay (Promega, USA) in MCF-7 cell lines ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
Neuronal L-Type Calcium Channel Signaling to the Nucleus Requires a Novel CaMKIIα-Shank3 InteractionbioRxiv - Neuroscience 2019Quote: ... Media was then removed and cells were incubated in serum-free DMEM containing either 0.49% dimethyl sulfoxide (Pierce) or a differentiation medium (serum-free DMEM supplemented with 10 ng/ml fibroblast growth factor (Promega), 240 μM isobutylmethylxanthine (Sigma) ...