Labshake search
Citations for Promega :
201 - 250 of 4696 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Forty-eight hours later, cells were treated with Thapsigargin (100nM, 4h) and cells were resuspended in passive lysis buffer (Promega). Firefly and Renilla luciferase activities were measured using a dual-luciferase reporter assay system (#E1960 ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were diluted with 20 mM HEPES pH 8.0 to a urea concentration of 2 M and the proteins were digested with 4 µl Trypsin/LysC (Promega V5073: 20ug + 80uL 50mM acetic acid) for 4 hours at 37°C and boosted with an extra 2µl Trypsin/LysC (Promega V5073 ...
-
bioRxiv - Neuroscience 2021Quote: ... Proteins were digested with 0.5 µg of lysyl endopeptidase (Wako) at room temperature for 4 hours and were further digested overnight with 1 µg trypsin (Promega) at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were incubated at 37°C for 1 hour and then proteolytic digestion was performed with LysC (Wako) for 4 hours and trypsin (Promega) overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... Washed beads were re- suspended in 150 µl digestion buffer and incubated for 4 hours with 1 µg trypsin (Promega) at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... lysyl endopeptidase (Wako) at room temperature for 4 hrs and were further digested overnight with 1:50 (w/w) trypsin (Promega) at room temperature ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Microbiology 2020Quote: ... Protein digestion was performed using 1:100 (w/w) LysC (Wako Chemicals) for 4 h at 37°C and then finalised with 1:50 (w/w) trypsin (Promega) overnight at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... The transfected cells were then treated with Aβ42 (1-4 μM) or calcitriol (100 nM) for 6 h before luciferase activity assay (Dual-Luciferase Reporter Assay, Promega). A 587-bp region of the human Cyp24a1 gene promoter that contains two VDRE motifs was cloned into the promoter-less luciferase expression vector pGL3-basic (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... the washed beads were re-suspended in 150 µl trypsin digestion buffer and incubated for 4 hours with 1 µg trypsin (Promega) at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... The antibodies used for western blotting were: anti-HALO (1:1000 in 0.5% milk TBST, 4°C o/n, Promega G9211), anti-GAPDH (1:10000 in TBST ...
-
bioRxiv - Bioengineering 2024Quote: ... and incubated with the following primary antibodies diluted in TBS-T overnight at 4°C: mouse anti-HaloTag (1:5,000; Promega, G9211), mouse anti-Flag M2 (1:2000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells were transduced with the shRNA lentiviruses and selected on puromycin for 4 days before lysis in 1× passive lysis buffer (E1941, Promega) and dual luciferase readout using the Dual-Glo® Luciferase Assay System (E2940 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plates were then incubated overnight at 4°C with primary antibodies (mouse anti-LgBIT antibody at 1:750 dilution [Promega N7100] ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGene HD (Promega, E2311, 1:3).
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Cell Biology 2024Quote: ... clarified by centrifugation (500 x g, 5 min, at 15°C) and mixed 1:1 with 2× passive lysis buffer (Promega cat #E1941). Cell monolayers were washed in PBS and lysed in 1× passive lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: ... beads were suspended in digestion buffer (Tris 50 mM pH 7.5, urea 2 M, 1 mM DTT and 5 µg.µl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Immunology 2021Quote: ... cDNA were synthesized from RNA (4 μg) using AMV Reverse Transcriptase (Promega). ...
-
bioRxiv - Immunology 2021Quote: CTLA-4 Blockade Bioassay was purchased from Promega (JA3001; Madison, WI, USA) and performed according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2020Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1-2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Systems Biology 2023Quote: ... initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 1–2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Neuroscience 2022Quote: ... Proteins were digested with 4 ug Trypsin/Lys-C mix (Promega V5073) for 3-4 hrs at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 µL furimazine (0.36% vol/ vol diluted in BRET assay buffer, Promega) was added before readout on ClarioStar.
-
bioRxiv - Cell Biology 2023Quote: ... After addition of 4 μl of RNAsin Plus ribonuclease inhibitor (Promega N2611), the samples were spun down ...
-
bioRxiv - Neuroscience 2023Quote: ... to an agar block (4% agarose, low melting point, analytical grade, Promega, Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then digested with 4 μg of Trypsin/lys-C (Promega) overnight at 37°C before being collected by centrifugation with washes of 100mM Tetraethylammonium bromide ...
-
bioRxiv - Neuroscience 2024Quote: ... followed by 4 µg of sequencing-grade LysC (Wako) and trypsin (Promega) for overnight incubation at 37°C ...
-
bioRxiv - Microbiology 2022Quote: ... the HSV-1 ICP0 3’UTR was amplified from pICP0(HSV-1) using psiV1ICP0UTRf and psiV1ICP0UTRr primers and inserted into psiCHECK-2 (Promega). psiChHVICP03UTR was constructed by inserting the synthesized ChHV ICP0 3’ UTR into the same position ...
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Neuroscience 2024Quote: Ensembl predicted regulatory region including the POU domain binding site on Aspm promoter/enhance (sequence from 5’-GAAAAAGTGGGCAGTAACTCGC-3’ to 5’-CAACCTTTCCCTGAGGACGATC-3’) was synthesized by Twist Bioscience and cloned into pGL3-Basic Luciferase Reporter vector (Promega) using the Gibson assembly method ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Neuroscience 2023Quote: ... was performed by incubating the proteins first with endoproteinase Lys-C (Wako, #125-05061,)) in 8 M urea for 4h at 37°C followed by an overnight trypsin digestion (Promega #V511A,) in 2 M urea at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... Virus-mAb-containing media was then aspirated from cells and 100 mL of a 1:4 dilution of Bio-glo (Promega, G7940) in PBS was added to cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Lysates were centrifuged at 500 g for 5 min at 4°C and resuspended in 4 mL of nuclei wash buffer (PBS supplemented with 1% BSA and 0.2U/μL RNasin® Plus Ribonuclease Inhibitor (Promega, N2615). Following another round of centrifugation ...
-
bioRxiv - Microbiology 2021Quote: ... Virus-mAb-containing media was then aspirated from cells and 100 μL of a 1:4 dilution of Bio-glo (Promega, G7940) in PBS was added to cells ...
-
bioRxiv - Biophysics 2024Quote: ... and incubated at 4°C overnight with the following primary antibodies diluted in TBS-T: mouse anti-HaloTag (1:8000; Promega, G9211), mouse anti-Flag M2 (1:2000 ...
-
bioRxiv - Cell Biology 2024Quote: ... pcDNA-LAAOR322A or pcDNA-LAAOY372A using FuGENE® HD transfection reagent at 1 µg plasmid / 4 µl transfection reagent (Promega, E2312).
-
bioRxiv - Genetics 2023Quote: ... Ovation Methyl-Seq kits to prepare RRBS libraries (with added Promega unmethylated cl857 Sam7 lambda control spike-in of 1 ng per 80-120 ng of sample) ...
-
bioRxiv - Cell Biology 2024Quote: ... 15 μl of methyl thiazolyl tetrazolium (MTT, Promega, Madison, WI, USA.) was added to each well and incubated for another 4 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a total of 18 RNA extractions (3 morphs × 3 tissues × 2 biological replicates) were performed using the SV Total RNA Isolation System (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... Cell viability was assayed 4 days post-seeding by Cell Titer Glo (Promega) and an Envision plate reader ...
-
bioRxiv - Pathology 2023Quote: ... 0.08 µL of GoTaq2 and 4 µL of its 5x corresponding buffer (Promega), and 5 µL of boiled calibrated bacterial suspensions ...
-
bioRxiv - Systems Biology 2023Quote: ... 4 μL of digestion buffer containing 20 ng/μL sequencing-grade trypsin (Promega), 20 ng/μL sequencing-grade Lys-C (Wako) ...
-
bioRxiv - Plant Biology 2024Quote: ... The reaction conditions were as follows: 4 μL of PCR 5X Buffer (Promega), 1 μl of MgCl2 (25 mM) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The following day cells were trypsinized and seeded in 384-well white plate (20 µl/well) in DMEM F12 (no phenol red, 4% FBS) +/-HaloTag® NanoBRET™ 618 Ligand (1 µl/ml, Promega) and +/-compounds (DMSO concentration in each sample was kept the same) ...
-
bioRxiv - Systems Biology 2023Quote: ... and digested using LysC 1:100 enzyme:proteins ratio for 4 hours (Wako sequencing grade, 125-05061) and trypsin 1:100 enzyme:proteins ratio for 16 hours (Promega sequencing grade, V5111). The digested proteins were then acidified with 10% (v/v ...