Labshake search
Citations for Promega :
101 - 150 of 4696 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 4 ng of Renilla control plasmid (Promega) and 0.62 μL of Lipofectamine 2000 Transfection Reagent (InvitrogenTM) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 U/mL RQ1 DNase (Promega), samples were incubated at room temperature (25°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 µL Mg2+ free PCR buffer (Promega), 4 µL 25 mM MgCl2 ...
-
bioRxiv - Biochemistry 2024Quote: Flexi Rabbit Reticulocyte Lysate (4 μL, Promega) was diluted with 4 μL solution containing amino acid mixture (100 μM) ...
-
bioRxiv - Microbiology 2024Quote: ... Cell viability was assessed after 2 and 5 days (i.e., 3 and 6 days post-treatment) using CellTiter-Glo (Promega) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2023Quote: ... at 10,000 x g and 4°C for 2 min and digested by addition of RNAse-free DNAse I (Promega) for 10 min on ice ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Physiology 2024Quote: ... The locus containing the rdu14 allele was amplified by PCR, using the following primers (Forward: 5’-TGATTCACACTACTTACTTGTCTAG-3’, Reverse: 5’-GATTAAAAGTAGTTATCTCATCCTCAG-3’) and GoTaq polymerase (Promega, ). The genotype of the locus was scored after resolving samples on 2.5% agarose gels as HNF4α+/+ ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were then incubated overnight at 4 °C with anti-p75NTR (Promega; G323A; 1:300) and anti-TRADD (Santa Cruz ...
-
bioRxiv - Cell Biology 2021Quote: ... Neurons were then incubated overnight at 4° C with anti-p75NTR (Promega; G323A; 1:500) and anti-TRAF6 (Santa Cruz ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C) and then resuspended in 100 µl 1 x Passive Lysis Buffer (PLB, Promega). 45 µl of the luciferase assay substrate dissolved in Luciferase Assay Buffer II was plated on a 96-well plate and 10 µl of the cell lysate was added immediately before measurement of Fluc activity using a Tecan reader ...
-
bioRxiv - Molecular Biology 2022Quote: ... Compound treatment was initiated 1-4 hours before transfections with FuGENE HD transfection reagent (Promega) following the manual ...
-
bioRxiv - Genomics 2024Quote: ... and transfected with 20µL of transfection mixture at 4:1 ratio of Fugene HD (Promega) to DNA in Optimem (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 nM of DNA and 4%(v/v) Green-Lys tRNA (FluoroTect GreenLys, Promega, USA) were added to the assembled PURE and incubated for 4h at 37 °C in a PCR thermocycler (Bio-Rad ...
-
bioRxiv - Cancer Biology 2024Quote: ... tissues were incubated with primary antibodies diluted in 10% DS in PB1 for 3 days at 4°C followed by four washes over the following day with 0.2% Tween-20 (Promega UK Ltd, H5151) in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Digested protein suspensions with 4 μg trypsin (Promega) in 40 μL 25 mM NH4HCO3 buffer at 37 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... 4 U RNasin Ribonuclease Inhibitor (Promega, Cat#N2115), 6 U Recombinant RNase Inhibitor (Takara ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 4 μL of RQ1 DNase (Promega, M6101) were applied to the lysate and incubated at 37 °C for 3 min ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... One 10-cm plate of HEK-293T cells at 90% confluency was transfected with 6.5 μg of the pBMN-ARHGAP36 (isoform 2)-mCherry mutant library and 4 μg of pCL-ECO using the FuGene HD transfection reagent (Promega). The medium was replaced after 24 hours with DMEM containing 1.8 mM L-glutamine ...
-
bioRxiv - Biophysics 2020Quote: ... Plasmids were transfected in cells (passage number < 35) seeded in 96-well plates at ~50 % confluence 2-4 days before the experiment with FuGene6 (Promega) or Lipofectamine 2000 (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... Plasmids were transfected in cells (passage number < 35) seeded in 96-well plates at ~50 % confluence 2-4 days before the experiment with FuGene6 (Promega) or Lipofectamine 2000/3000 following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein was then digested with 2.5 μg Lys-C (Wako, Japan) for 4 h at 37°C and 2 μg trypsin (Promega, V5113) for an additional 4 h at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 4 h later 5 µl/well of NanoBRET™ Nano-GloR Substrate (10 µl/ml in DMEM no phenol red, Promega) was added and 460 nm donor and 618 nm acceptor signals were read within 10 min of substrate addition using CLARIOstar microplate reader (Mandel) ...
-
bioRxiv - Biochemistry 2024Quote: ... Excess solution was discarded and gel pieces were dried at room temperature for 30-45 min followed by an incubation at 4°C for 30 min with 20 µl 5 ng/µl trypsin (sequencing grade Promega, V5111) in 50 mM AHC ...
-
bioRxiv - Cell Biology 2021Quote: ... for 4 h at 800 rpm and 42°C or thermolysine (1:50) (Promega, Walldorf, Germany) for 2 h at 800 rpm and 60°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µL of PBS containing 4 μg/mL Hoechst and 1/10000 CellTox Green Dye (Promega) were were dispensed per well 1 h prior to imaging at Cytation5 image cytometer or Opera Phenix (Perkin Elmer ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MEK inhibitor U0126 (1, 10, and 50 µM for 4 h; Promega, Madison, WI, USA). A corresponding volume of dimethyl sulfoxide (Nacalai Tesque ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Plant Biology 2023Quote: ... LUC images were taken 2-3 days after infiltration by applying 1 mM Beetle luciferin (Promega) on adaxial leaf surface.
-
bioRxiv - Cancer Biology 2024Quote: ... and then incubated overnight at 4°C with mouse anti-HiBiT antibody (Promega #N7200; 1 µg/mL; diluted 1:1000) in 1X PBS containing 5% BSA ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μL of CellTiter-Glo® (Promega cat#: G7570) were added to each well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Samples were washed and endogenous biotin was blocked using Avidin/Biotin blocking kit (Vector laboratories ...