Labshake search
Citations for Promega :
2301 - 2350 of 4516 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
The human sperm basal body is a complex centrosome important for embryo pre-implantation developmentbioRxiv - Developmental Biology 2021Quote: ... The resulting protein extract was first diluted to 2M urea for overnight digestion with LysC (Wako, USA) at 37°C and then diluted 2-fold for 8 h digestion with trypsin (Promega, USA) at 37°C.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 106 cells of each strain were mixed completely with equal volumes of the BacTiter-Glo reagent (Promega Corporation, Madison, WI), followed by incubation at room temperature for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Immunology 2024Quote: ... Quantification of SARS-CoV-2 RVP infection was determined using the Renilla-Glo® luciferase assay system (Promega Corp., Madison, WI). Microtiter assay plates were centrifuged for 5 min at 2000 rpm to prevent cell loss ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 µg of bacmid DNA were used to transfect Sf21 cells for baculovirus generation using FuGENE® transfection reagent (Promega). The protein was expressed in Lonza Insect-EXPRESS™ medium for 72-96 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Microbiology 2023Quote: ... for 2 hours at 72 hours and lysed at 98 hours using 25 μl Dual-Glo® Luciferase Assay System (Promega). Luminescence was measured ...
-
bioRxiv - Microbiology 2024Quote: ... Contaminating DNA in the samples were removed through incubation at 37°C for 2 h using RNase-free DNase I (Promega, USA). All RNAs in the samples were converted into cDNA using a cDNA EcoDry Premix (Clontech ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of RNA was used astemplate to generate cDNAs using the ImProm-II Reverse Transcription system (Promega, Madison, Wisconsin, USA). qPCR reactions were carried out on an MX3000P system (AgilentTechnologies ...
-
bioRxiv - Microbiology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based viability assay (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega) was performed as previously described (25).
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µl of the lysed samples were added to 25 µl PCR reactions with GoTaq Green mastermix (Promega, Cat. No. M7123). After amplification ...
-
bioRxiv - Cell Biology 2020Quote: ... The BrdU/C labelled DNA strand was digested with 10 U/ml Exonuclease III (Promega M1811) for two rounds of 10 min at RT ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... Sigma-Aldrich)–coated dishes or glass coverslips with 30 ng/ml of 2.5 S mouse NGF (G5141, Promega) in the Neurobasal medium containing B27 supplement (17504044 ...
-
bioRxiv - Immunology 2021Quote: ... Transformants were grown overnight in LB media with 50 µg/mL kanamycin and mini-prepped (Promega). Mutagenesis was validated by Sanger sequencing (Genewiz) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 10 µL of a 0.1 mg/mL stock solution of trypsin (Promega Trypsin Gold MS grade) in 5 mM acetic acid was freshly diluted into a 140 µL solution of 10 mM NH4HCO3 to make the working digestion solution ...
-
bioRxiv - Microbiology 2020Quote: ... 85 ul of 10% SDS solution and 40 ul of Proteinase K (15mg/ml, MC500B Promega) were added and samples were incubated for 30 minutes at 60° C ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were either treated with 50ng/ml rat Nerve Growth Factor (NG; Promega, Madison, WI, USA) at 0 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 mM iodoacetamide (IAA) and proteins were eluted by digestion with 5 µg/ml trypsin (Promega). Eluted proteins were fully digested overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were lysed for 30 min in buffer A supplemented with either 100U/ml RNasin (Promega) for untreated and GTX conditions ...
-
bioRxiv - Genetics 2022Quote: ... Supernatants were discarded and the remaining 0.2 mL were digested with DNases (Promega and Epicentre, USA), RNase A (Ambion ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Fifty microliters of D-luciferin (30 mg/mL in saline) was injected subcutaneously in mice (Promega). Twenty minutes after the injection ...
-
bioRxiv - Plant Biology 2022Quote: ... and GST- GBF3 were purified from 4 ml culture and immobilized on MagneGST Glutathione particles (Promega). Briefly ...
-
bioRxiv - Systems Biology 2024Quote: ... After 48 hours each plate was treated with 25 mL’s of CellTiter Glo (Promega Corp G7572) and read in enhanced luminescence mode on an EnVision Multi-Label plate reader (Revvity Corp.) ...
-
bioRxiv - Microbiology 2024Quote: ... The only exceptions being the use of 2.5 mL of 10x FastBreak Cell Lysis Reagent (Promega) to lyse the 1 L cell pellets and the Gel Filtration Buffer (25 mM Tris-HCl pH 8 ...
-
bioRxiv - Molecular Biology 2024Quote: ... The samples underwent overnight on-bead digestion with 3.5 µl of trypsin (0.1 mg/mL, Promega) and were dissolved in 50 mM acetic acid in elution buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... were analyzed with the addition of luciferin (100mg/mL) or furimazine (Nano-Glo® Luciferase, Promega) diluted 1:200 to 1:500 in 1X PBS ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated in 1.5 mL per well of 20 nM TMR HaloTag ligand (Promega, G8251) in pre-warmed medium for 15 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... Half of the lysis was treated with 5 µl of 10 mg/ml Rnase (Promega:527491) and both lystates (+/- RNase ...
-
bioRxiv - Biochemistry 2023Quote: ... and sequencing grade trypsin (10 μL, 0.5 mg/mL in 50 mM ammonium bicarbonate, Promega, V5111) were added for overnight incubation at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μl of NanoBRET™ Nano-Glo Substrate solution (8 μl/ml Nano-Glo substrate, Promega, diluted in DMEM/F12 no phenol red ...
-
bioRxiv - Genomics 2023Quote: ... 500 μl of CTAB lysis buffer and 10 μl of Proteinase K (20 mg/ml; Promega) were added to the sample and incubated at 65ºC for 90 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... mice received intraperitoneal injection of 50 μl 30 mg/ml d-luciferin (in PBS) (E1603, Promega). Continuous administration of isofluorane gas was provided to maintain anaesthesia of animals during imaging ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704, digitonin 0.01% - Promega #G9441, Tween-20 0.1%, PBS 33%). The transposition reaction was purified (Qiagen MinElute PCR Purification kit ...
-
bioRxiv - Biochemistry 2024Quote: ... 100 μL of culture supernatant was removed from each well and replaced with 100 μL of ONE-Glo luciferase reagent (Promega, Madison, WI, Cat# E6110). The plates were gently mixed by rocking for 10 min at rt ...
-
bioRxiv - Immunology 2021Quote: The caspase-1 activity assay was performed using the Caspase-Glo 1 inflammasome assay from Promega (G9951) as per the manufactures instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... The proteins were digested with 1 μg lysyl endopeptidase (LysC) (FUJIFILM Wako) and 1 μg trypsin (Promega) overnight at 37°C on a shaking incubator ...