Labshake search
Citations for Promega :
2001 - 2050 of 2791 citations for Mono 2 Ethyl 5 Hydroxyhexyl Phthalate 13C4 99% Dehp Metabolite Ix 100 Ug Ml In Mtbe since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained at 37 °C and 5% CO2.Cell lines were authenticated using Short Tandem Repeat fingerprinting carried out using the GenePrint 10 system (Promega). For 3D spheroids ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final 50 µL translation reaction included the 5 µL RNA mixture described above and components from the Rabbit Reticulocyte Lysate system (Promega): 35 µL of rabbit reticulocyte lysate ...
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
FACS-Sortable Picoreactors for Ultra High-throughput Screening of Catalysts in Biphasic EnvironmentsbioRxiv - Bioengineering 2024Quote: ... emulsions of octanol + 5% (w/v) Span 80 + 40 µM Nile Red in an aqueous phase of nuclease free water (Promega) + 200 ng/µL miniprepped plasmid + 5% (w/v ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Microbiology 2023Quote: ... The viability of Vero cells treated with 5-FU and EIDD-1931 alone were assessed using CellTiter-Glo Viability Assay (Promega).
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µL of digestion solution (1.25 mM TCEP, 5 mM chloroacetamide, 0.2 µg trypsin/Lys-C mix (Promega, cat#V5073), in 100 mM HEPES pH 8.5 ...
-
bioRxiv - Molecular Biology 2024Quote: About 5 μg empty pcDNA3 vector or ZNF410 full-length and ZNF410-ZF plasmids was transiently transfected with FuGENE 6 (Promega) into 10 cm plates of COS-7 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were treated 24h after seeding and cell viability was assessed 5 days after treatment using the Cell Titer-Glo luminescent cell viability assay (Promega). Cells treated with vehicle control DMSO (0.1% ...
-
bioRxiv - Neuroscience 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Biophysics 2024Quote: ... was incorporated at the 5’ end of the FL open reading frame during PCR amplification from a pRL-CMV vector (Promega). A Kozak consensus sequence and a 50-nucleotide upstream region was incorporated before the translation start site to ensure enough space for the assembly of translation initiation complex77 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... The inoculum was added to HEK293T cells and incubated at 37 ° C with 5% CO2 and the luciferase signal was with analyzed using luciferase assay kit (Promega).
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was annealed with 0.1 mg/ml oligo(dT)15 primer (Promega) and cDNA synthesis was performed with M-MLV Reverse Transcriptase (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... and digested in 10 µg/ml Trypsin Gold (Mass Spectrometry Grade, Promega, V5280) overnight at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... and suspended LysC solution (Promega, 12.5ng/mL in 25mM Tris-HCl pH 8.5). Digestion was performed overnight at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... ATP (0.2 mM) and/or protein kinase A (0.1 mg/mL; PKA, Promega) were then added to hydrogel droplets for 12 hours at 25 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... gel pieces were dried and rehydrated with 12.5ng/mL trypsin (Promega, Madison, WI) solution in 25mM ammonium bicarbonate on ice for 30min ...
-
bioRxiv - Microbiology 2021Quote: ... cells were lysed in 200 ml Dual Luciferase Passive Lysis Buffer (Kit Promega) and both Luciferase (FF-Luc ...
-
bioRxiv - Pathology 2021Quote: ... pre-treated with DNAse (50u/ml, 15min RT, RQ1 RNAase free DNAse, Promega) and cytoplasmic fractions were adjusted ...
-
bioRxiv - Plant Biology 2020Quote: ... One mL of 1X cell lysis buffer from the luciferase assay system (Promega) was added to each sample ...
-
bioRxiv - Genomics 2021Quote: ... Sorted cells were then unfixed overnight in 50 μg/mL proteinase K (Promega) plus 150 mM NaCl at 65°C ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease inhibitor (1 uL/ml; Promega, Madison, WI; Cat#N2511). These washes were followed by an additional wash with 500 μl each of both wash buffer and high salt wash buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant RNasin ribonuclease inhibitor (1 ul/ml; Promega, Madison, WI; Cat#N2511) with a mechanical homogenizer followed by addition of TURBO DNase (2 μl ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.5ul “home-made” Tn5 transposase adapter complex and 0.4mg/ml digitonin (Promega, #G9441) at 30 min at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... one of which was incubated with 50 µg /ml of RNase A (Promega) at 37 °C for 30 min ...
-
bioRxiv - Genetics 2023Quote: ... and 0.45% Tween-20) with Proteinase K (20mg/ml, Promega, Cat. No. MC5005) added just before use ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 10 μL/ml RNasin® Plus Ribonuclease Inhibitor (Promega, Madison, WI, USA). The tissue lysates were then homogenized on ice and 1% of each lysate volume was separated as Input samples ...
-
bioRxiv - Biochemistry 2024Quote: ... The remainder of the reaction was treated with 50 µg/mL trypsin (Promega) and incubated at room temperature for the indicated times ...
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA (2 µg) was reverse transcribed into cDNA using a cDNA synthesis kit (Promega, Madison, WI, USA). The RT-PCR was assessed using r-Taq plus Master Mix (Elpis Biotech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Dual luciferase assay was performed 2 days post transfection using the Nano-Glo Dual-Luciferase Reporter Assay (Promega) in a Synergy Neo2 microplate reader (Biotek) ...
-
bioRxiv - Microbiology 2019Quote: DENV-2 viral RNA was extracted from sera using the Viral Total Nucleic Acid Kit (Promega, Madison, WI) on a Maxwell 48 RSC instrument (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected with CRISPR–Cas9 and donor plasmids (Table 2) using FuGENE HD Transfection Reagent (Promega, #E2311) in a 6-well plate following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments with lengths is above 500 bp to 2 kb were carried out with GoTaq enzyme (Promega) according to standard protocols ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μg of DNAse free RNA was used for cDNA synthesis using ImProm-II Reverse transcription system (Promega), as per the manufacture’s recommendation ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were further diluted to a final urea concentration of 2 M and proteins digested with trypsin (Promega) (1/100 ...
-
bioRxiv - Cell Biology 2021Quote: ... promoter fragments were cloned in front of the Renilla luciferase ORF (hRluc) into the psiCHECK-2 vector (Promega, Cat# C8021 ...
-
bioRxiv - Microbiology 2020Quote: ... PCR#2 product was ligated to pGEM-T easy vector or TOPO vector following the manufacturer’s instructions (Promega). After transformation in bacteria and plasmid amplification ...
-
bioRxiv - Microbiology 2022Quote: ... virus was removed and cells were transfected with 2 µg of plasmid DNA pUCSP-A24Rcd using FuGeneHD (Promega) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 8.0) with 2-5µg plasmids pre-digested by XcmI and 50 µg of herring sperm carrier DNA (Promega), then 700 µL of yeast transformation buffer (40% (w/v ...
-
bioRxiv - Bioengineering 2022Quote: ... Uptake of 2-deoxyglucose by the adipocytes was measured using a Glucose Uptake-Glo™ Assay kit (Promega) and luminescence was measured according to the manufacturer’s instructions using a plate reader ...
-
bioRxiv - Molecular Biology 2020Quote: ... The bacterial surface proteins with attached plasma proteins were released by limited proteolysis with 2 μG trypsin (Promega) /37 °C ...
-
bioRxiv - Genetics 2022Quote: ... 2 µl of the extracted genome solution was used as a template for Genome PCR by GoTaq (Promega). The sequences of gw182 gene specific primer set designed around the CRISPR target site were 5’ -GAG TCC AAT TTG AGA AAC GGA GGT CA-3’ and 5’ - CTG ATC GTT TGC GCT TAA CTT CAT TAA TTC T-3’ ...
-
A critical role for heme synthesis and succinate in the regulation of pluripotent states transitionsbioRxiv - Developmental Biology 2022Quote: RNA was extracted after 2 days of culture with the ReliaPrep™ RNA Tissue Miniprep System (Promega, Z6111) following manufacturer’s protocol for non-fibrous tissue by adding RNA lysis buffer on pelleted cells ...
-
bioRxiv - Genetics 2020Quote: ... cells were changed into GloSensor equilibration medium (10% fetal bovine serum and 2% GloSensor assay reagent (Promega E1290) in CO2-independent medium (Gibco 18045-088) ...