Labshake search
Citations for Promega :
151 - 200 of 2807 citations for Recombinant Human Lectin Galactoside Binding Soluble 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega) resulting in the NoV-GII plasmids ...
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...
-
bioRxiv - Genomics 2020Quote: ... Viral RNA was extracted using the silica guanidinium isothiocyanate binding method (12) adapted for the ThermoFisher Kingfisher using paramagnetic silica particles (Magnesil, Promega).
-
bioRxiv - Developmental Biology 2019Quote: ... together with a TOPFLASH luciferase reporter construct containing synthetic Tcf-binding sites (Korinek et al., 1998) and a Renilla-luciferase reporter (Promega) for normalization ...
-
bioRxiv - Evolutionary Biology 2020Quote: To generate the pGl3-STK38-P luciferase reporter,1.2 kb of DNA upstream the STK38 TTS promoter region with ZNF611 binding motif was amplified by polymerase chain reaction (PCR) and cloned into the Firefly luciferase reporter plasmid pGL3-Basic (Promega) using KPN1 and XHO1 restriction sites.0.7 kb of DNA upstream the STK38 TTS promoter region without ZNF611 binding motif was cloned into pGL3-Basic using same restriction sites to generate the pGl3-STK38-ΔP luciferase reporter ...
-
bioRxiv - Microbiology 2022Quote: ... containing the specific primers-probe binding sites were synthesized for NoV GII and cloned into the pGEM-T Vector (Promega), resulting in the NoV-GII plasmids ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... bulked to 200ng using human genomic DNA (Promega). All samples were sheared for 150 seconds using a Covaris E220 (Duty Factor 5% ...
-
bioRxiv - Systems Biology 2020Quote: The Human cell lysate was obtained commercially (Promega) and the yeast digest was prepared as previously described23 ...
-
bioRxiv - Genomics 2019Quote: ... We added 4μl pooled commercial human gDNA (Promega) to all samples to ensure total gDNA > 1μg/35μl ...
-
bioRxiv - Immunology 2021Quote: ... 3) goat anti-human H+L (Promega, W403B) at 1:3,000 dilution ...
-
bioRxiv - Biochemistry 2020Quote: ... Human GSK-3β was purchased from Promega (V1991).
-
bioRxiv - Genomics 2020Quote: ... and human gDNA (Promega, San Luis Obispo, CA) was added to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2021Quote: ... and SETD2 human ORF were procured from Promega. Deletion mutants of hnRNP L ...
-
bioRxiv - Biochemistry 2022Quote: Human cancer cell line digest standards K562 (Promega) and diluted to 100 microgram/mL in 50mM TEAB and labeled with TMTPro reagents according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 BAC, KSHV BAC, human genome Promega #G1471, mouse genome Promega #G3091), or purified plasmids (MHV68 ORF50) ...
-
bioRxiv - Plant Biology 2023Quote: ... The recombinant proteins were purified with MagneGST™ Protein Purification System (www.promega.com/protocols/; Promega, Madison, WI, USA).
-
bioRxiv - Immunology 2023Quote: ... 10µg of recombinant C5AP and PRGA was trypsinized with 1µg of trypsin (Sequencing Grade Modified Trypsin, Promega) for 15 min at 37°C and the trypsin activity was inhibited by incubating at 100°C for 5 min ...
-
bioRxiv - Plant Biology 2024Quote: ... The recombinant GST-OsNAC5 fusion protein was subsequently purified with the MagneGST™ Protein Purification System (Promega), following the provided protocol.
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Developmental Biology 2021Quote: A partial TWD1 fragment of 150 bp covering the TPR domain and a part of the calmodulin binding domains (aa 264-314) was PCR amplified and cloned into pGEM-T-Easy Vector (Promega Corp.) and verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (150 bp) one putative ETV2 binding site (Wei et al, 2010) were cloned into pGL3_Basic vector (Cat# E1751, Promega, Madison, WI). Primers Forward ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Molecular Biology 2019Quote: The 3’ UTR of target mRNAs spanning at least 500 bp around the predicted miRNA binding sites were cloned into the psi-CHECK2 vector (Promega, C8021) downstream of the Renilla luciferase gene (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: FOXM1 3’UTR region comprising of miRNA binding region was cloned into pmirGLO-Dual Luciferase miRNA target expression vector for miRNA luciferase reporter assay (Promega, USA) in MCF-7 cell lines ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... and human Renilla luciferase (pGL4.74[hRluc/TK], Promega, E6921) were used in the study ...
-
bioRxiv - Microbiology 2020Quote: ... insert (NRP1, native human ORF in pF1K, FXC23812, Promega): 5’-atagggcgaattcggtagtaaggagcgatcgc-3’ (fwd ...
-
bioRxiv - Cancer Biology 2022Quote: ... were amplified by PCR from human genomic DNA (Promega), using the primers listed in Table S1 and then inserted into the psiCHECK-2 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... human GR and MR were cloned into pACT (Promega) as N-terminal VP16 fusions using HiFi assembly (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... A cDNA encoding human KIF1A was purchased from Promega Japan (Promega Japan ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Human PAR2 with N-terminal nano-luciferase (nLuc, Promega) and C-terminal enhanced Yellow Fluorescent Protein (eYFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... or goat anti-Human IgG (H+L) (Promega, W4031) antibodies were added for 30 min at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tagged and GST-tagged recombinant proteins were purified using Promega MagneHis™ Ni-Particles (Promega Cat#V854A) and MagneGST™ Glutathione Particles (Promega Cat# V861A ...
-
bioRxiv - Microbiology 2020Quote: ... and clones of the recombinant vector was obtained using Wizard® Plus SV Minipreps DNA Purification kit (Promega). The pACD4K-C vector contains a T7 promoter and ...
-
bioRxiv - Microbiology 2022Quote: ... The reverse transcription (RT) mix contained 200 units of recombinant Moloney Murine Leukemia Virus (MMLV) reverse transcriptase (Promega), 20 units of RNAsin (Promega) ...
-
bioRxiv - Molecular Biology 2022Quote: ... was mixed with the supernatant (total protein amount of 20-30 μg) supplemented with 6.4 mM MgCl2 and 0.5 U/μl Recombinant RNase Inhibitor (Promega) in total volume of 30 μl ...
-
bioRxiv - Developmental Biology 2023Quote: ... modified hypotonic lysis buffer with a 10-fold higher concentration of Cycloheximide and Recombinant RNasin Ribonuclease Inhibitor (Promega) was used instead of RNase OUT ...
-
bioRxiv - Cell Biology 2020Quote: ... and the sequence encoding a genetically modified firefly luciferase into which a cAMP-binding domain has been inserted from the pGloSensor-20F (Promega, Cat #E1171).
-
bioRxiv - Cancer Biology 2020Quote: The wild-type 3’UTR region of SALL4 mRNA or a mutant without the miR-205 binding site (Figure 4E) was amplified using PCR and cloned into the pGL3 vector (Promega, Madison, USA). HEK 293T cells were seeded into 24-well plates ...
-
bioRxiv - Bioengineering 2021Quote: ... Cell lysates were pre-cleared of any non-specific streptavidin-binding proteins by incubating with 60 µL of MagneSphere paramagnetic particles (Promega, Madison, WI) for 30 min with rotation ...
-
bioRxiv - Cancer Biology 2019Quote: The GAS5 fragment sequences holding the binding sites of miRNA-106a-5p were synthesized and then inserted into the pGL3 luciferase reporter vector (Promega, WI, USA). HEK293T cells were co-transfected with the constructs encompassing the wild type GAS5 (GAS5-WT ...
-
bioRxiv - Molecular Biology 2019Quote: The putative LINC00662 binding regions within the ELK4 gene were amplified by PCR and cloned into downstream of pmirGLO dual-luciferase vector (Promega, Madison, WI, USA) to form the wide-type plasmid (ELK4-3’UTR-Wt ...
-
bioRxiv - Biochemistry 2021Quote: ... or mutant type (MT) and KCNQ1OT1 binding sites were synthesized and replicated onto a pGL3 Dual□luciferase Target Vector (Promega, Madison, WI, USA), to create Wild Type and Mutant Type let-7a-5p plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... of SNHG16 sequence and the 3’-untranslated region (UTR) fragment of STARD9 containing miR-1301-3p binding site were subcloned into the pmirGLO vectors (Promega, Madison, WI, USA) to generate SNHG16-Wt/Mut vectors and STARD9-Wt/Mut vectors ...
-
bioRxiv - Molecular Biology 2021Quote: ... 7 pmol biotinylated RNAs were incubated with streptavidin beads in the binding buffer supplemented with 80 U RNasin (Promega, Germany, Cat. No. N2511) and 50 µg yeast tRNA (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: The CD19 minigene was amplified from human genomic DNA (Promega) with the primers 5’-catAAGCTTgaccaccgccttcctctctg-3’ and 5’-catGAATTCNNNNNNNNNNNNNNNGGATCCttcccggcatctccccagtc-3’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the human CB1R was cloned into the pCI vector (Promega), and eCB2.0 and eCBmut were cloned into the peGFP-C1 vector (Takara) ...
-
bioRxiv - Immunology 2022Quote: ... and a β-globin calibration curve (human genomic DNA [Promega]) was concurrently evaluated on each plate ...