Labshake search
Citations for Promega :
101 - 150 of 2807 citations for Recombinant Human Lectin Galactoside Binding Soluble 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Cell Biology 2020Quote: ... GST fusion proteins were isolated by binding to glutathione magnetic beads (MagneGST™ Glutathione Particles, Promega) for 30 min at room temperature on a rotating wheel ...
-
bioRxiv - Molecular Biology 2021Quote: ... and recombinant plasmids were isolated using the Pure Yield Plasmid Miniprep System (Promega). Sizes of purified plasmids were verified by agarose gel electrophoresis ...
-
bioRxiv - Biochemistry 2022Quote: ... ~2.5 μg recombinant bacmid DNA and 3 μl FuGENE HD Transfection reagent (Promega) in 100 μl Sf900 II media (Invitrogen ...
-
bioRxiv - Physiology 2020Quote: ... using recombinant active SGK1 as a positive control following the manufacturer’s instructions (Promega). The kinase and ATPase reactions of SGK1 were carried out at 30°C for 1 hr using 400 μM ATP and a designed peptide (Murray et al. ...
-
bioRxiv - Genomics 2022Quote: ... Recombinant bacmid DNA was isolated using the SV genomic DNA isolation kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: Ni-NTA beads were firstly digested with 500 ng recombinant Lys-C (Promega) at RT while shaking at 1,400 rpm ...
-
bioRxiv - Cancer Biology 2019Quote: ... Marinnisen and the pG5 Luc (minimum promoter containing 5 sites for GAL4 binding) was purchased from Promega. The expression plasmid for Nrf2 WT ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...
-
bioRxiv - Genomics 2021Quote: ... 50ng human genomic DNA (Promega, G304A), 2µM assembled T7-Tn5 transposase or Tn5 transposase was incubated at 55 °C for 7minutes ...
-
bioRxiv - Immunology 2023Quote: ... Lumit Human IL-1β Immunoassay (Promega) was performed according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... human Female genomic DNA (Promega #G1521), as a reference ...
-
bioRxiv - Developmental Biology 2019Quote: ... we produced recombinant H3 mutant proteins from mRNAs using rabbit reticulocyte lysate (Promega L4600). After 3h of incubation at 4°C in interphase extracts followed by another 3h incubation with anti-HA beads ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were resuspended in reaction buffer [RNase inhibitor (0.2U/μL Recombinant RNAsin (Promega, PAN2515), 1% Fatty-acid-free BSA in PBS (Proliant ...
-
bioRxiv - Biochemistry 2024Quote: ... The HaloTag-JF503-SWSAP1 was quantified by using recombinant HALO-GFP protein standard (Promega) pre-incubated with JF503 at a 1:1 molar ratio and titrated into single molecule buffer (20 mM Tris pH7.5 ...
-
bioRxiv - Microbiology 2024Quote: Recombinant FIKK kinase domains activity was measured using the ADP-Glo kinase assay (Promega), which quantifies the amount of ADP produced during the kinase reaction ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 ng/μl of mRNA and 6 ng/μl QuantiLum Recombinant Luciferase protein (Promega) were coinjected ...
-
bioRxiv - Cancer Biology 2022Quote: ... Annexin V binding to PS was measured using the RealTime-Glo™ Annexin V luminescence assay (#JA1000; Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Recombinant TgGat1 (0.625-2.5 µM) was incubated with a given UDP-sugar (50 µM) (Promega) in 50 mM HEPES-NaOH (pH 7.4) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... QuantiLum Recombinant Luciferase and the BrightGlo Luciferase Assay System were acquired from Promega (Madison, WI). The HIV-1 inhibitor temsavir was acquired from ViiV Healthcare (Brentford ...
-
bioRxiv - Microbiology 2021Quote: ... recombinant TgPDEs or immunoprecipitated TgPDEs were assayed using the PDE-Glo Phosphodiesterase Assay kit (Promega) according to the manufacturer’s instructions with a few modifications ...
-
bioRxiv - Systems Biology 2019Quote: Cells were lysed and recombinant proteins were isolated using Magne® HaloTag® Beads (Promega) as previously described (15) ...
-
bioRxiv - Immunology 2020Quote: ... Mice were tested individually in duplicates by stimulation with recombinant luciferase (13μg/ml, Promega, #E1701), SARS-CoV-2 spike protein (10μg/ml) ...
-
bioRxiv - Plant Biology 2023Quote: ... in the presence of 20 units of RNasin (Recombinant Ribonuclease Inhibitor, Cat. No. C2511; Promega) and dNTP mix at a final concentration of 0.5 mM of each dNTP (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... all the steps were done in the presence of RNase inhibitor (recombinant RNasein, Promega, N2511) diluted 1:4,000 for washing steps or 1:400 for incubation while staining and for buffers in the tubes containing the sorted cells followed by snap freeze and storage at –80°C.
-
bioRxiv - Biochemistry 2023Quote: ... 10 μg of the isolated recombinant bacmid and 5 μL Fugene HD transfection reagent (Promega) were diluted in 150 μL Sf-900™ III SFM ...
-
bioRxiv - Microbiology 2019Quote: ... Human genomic DNA (Promega, Madison, WI, USA) was diluted to 10,000 genome copies per μl then serially diluted to 10 genome copies per μl and used to create a human DNA copy number standard curve ...
-
bioRxiv - Molecular Biology 2019Quote: ... The natural templates include purified human (Promega), rhesus monkey (BioChain) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human Genomic DNA Male (Promega, cat # G1471) and IDH1 R132H Reference Standard (Horizon ...
-
bioRxiv - Cancer Biology 2020Quote: ... 50ng of normal human genomic DNA (Promega) was used as a negative control ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human LAMA1 cDNA was purchased from Promega and sub-cloned into pLVX-Tet-On Advanced vector (Clontech) ...
-
bioRxiv - Genomics 2021Quote: Commercial human DNA (Promega, Cat. No. G1521) was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... These included 5μg/ml human gDNA (Promega), 500ng/ml citrullinated histones (Cayman Chemical #501620) ...
-
bioRxiv - Microbiology 2023Quote: ... Human gDNA (Promega, San Luis Obispo, CA) was added to the extracted gDNA from the clinical swabs to reach a total input of 3 μg/130uL for fragmentation and library prep ...
-
bioRxiv - Biochemistry 2024Quote: ... a K562 human peptide digest standard (Promega) and E.coli peptide standard (Waters ...
-
bioRxiv - Genomics 2023Quote: ... Human male genomic DNA (Promega, CAT #G1471) was used for a standard curve at 125 pg/µL ...
-
bioRxiv - Microbiology 2020Quote: ... After washing with 150 μL of binding buffer four times the samples were subjected to proteolytic digestion using 1.2 μg trypsin (sequencing grade, Promega) for 2h at 47°C ...
-
bioRxiv - Physiology 2023Quote: The enhancer region containing the FXR binding element was amplified by PCR and cloned into the pGL4.23 vector (Promega). HepG2 cells were transiently transfected with FXR (100 ng/well ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: The plasmid pEGFP-C1-human Rab29 was generated by inserting human Rab29 sequence from pFN21A-Halo-Rab29 (Promega, #FHC08084) into Bgl II - Eco RI site of pEGFP-C1-rat Rab29 plasmid that was used previously11 ...
-
bioRxiv - Biochemistry 2021Quote: To investigate enzymatic activity of recombinant PfGSK3 a commercial luminescence-based kinase assay (KinaseGlo Plus, Promega) was used as previously described (93) ...
-
bioRxiv - Molecular Biology 2021Quote: ... These recombinant plasmids were subsequently used to generate digoxigenin-labelled riboprobes using the Riboprobe System (Promega) with SP6 or T3 RNA polymerases and digoxigenin-labelled Uracil triphosphate (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant EbfC was expressed in Escherichia coli Rosetta II cells and purified using MagneHis Particles (Promega) as previously described (24 ...
-
bioRxiv - Molecular Biology 2021Quote: The minimal CYC1 promoter with seven tetracycline binding sites was amplified from the yeast Tet-Promoters collection35 with YG4866/YG4867 and cloned into pGEM-Teasy (Promega) to create pCB4695 ...