Labshake search
Citations for Promega :
151 - 200 of 5331 citations for Rat Protein Glutamine Gamma Glutamyltransferase 2 TGM2 ELISA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Plant Biology 2023Quote: ... Purified DNA was run on 2% agarose gel and bands corresponding to ∼150 bp were cut and purified with a Gel Purification kit (Promega). Libraries were constructed using the Nugen Ovation Ultralow Library System V2 following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2022Quote: ... cDNA was then synthesized using 2 μg of mRNA and a Transcriptase first-strand cDNA synthesis kit (Promega, Madison, WI). Real-Time qPCR to detect the indicated targets was performed on a LightCycler® 480 System (Roche Life Science ...
-
bioRxiv - Molecular Biology 2024Quote: 3′-RACE assays were conducted using 2 μg of total RNA extracted from HEK293 cells using an RNA isolation kit (Promega) following established protocols (Shaji ...
-
bioRxiv - Immunology 2024Quote: ... and 2 mg/ml 3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]2-[4-sulfophenyl]-2H-tetrazolium (PMS, Promega) (1/20 ...
-
bioRxiv - Plant Biology 2024Quote: ... Proteins were expressed with TNT SP6 High-Yield Wheat Germ Protein Expression System (Promega) and reactions were incubated for 12h at 25°C with 10µg pIX-HALO expression clone ...
-
bioRxiv - Plant Biology 2023Quote: ... and the total protein contents were quantified using BCA Protein Assay Reagent (Promega Corporation). The supernatants were stored at –80 ℃ until subsequent analysis.
-
bioRxiv - Cell Biology 2024Quote: ... Protein samples were digested with trypsin/Lys-C mix (1:25 protease: protein; Promega) at 37°C was performed with constant mixing using a thermomixer ...
-
bioRxiv - Genomics 2022Quote: ... and the LgBiT Protein (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Magne Protein G beads (Promega) were used to purify the antibodies according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... In vitro translated proteins (Promega SP6-TNT Quick rabbit reticulocyte lysate system ...
-
bioRxiv - Biophysics 2023Quote: ... Protein samples were trypsinized (Promega) in 40mM ammonium bicarbonate (FISHER SCIENTIFIC) ...
-
bioRxiv - Cancer Biology 2022Quote: ... A BCA protein assay (Promega) was used to determine protein concentration ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... HiBiT control protein (#N301A, Promega) dilutions were prepared in the same medium and added (10 µl/well) ...
-
bioRxiv - Biochemistry 2023Quote: ... with purified LgBiT Protein (Promega). Briefly ...
-
Pushed to the edge: hundreds of myosin 10s pack into filopodia and could cause traffic jams on actinbioRxiv - Cell Biology 2024Quote: HaloTag standard protein (Promega, G4491) samples ...
-
bioRxiv - Systems Biology 2024Quote: ... cerevisiae protein lysate (V7461, Promega) to generate three samples ...
-
bioRxiv - Molecular Biology 2024Quote: ... yeast protein extract digest (Promega) standards was analysed throughout the measurement.
-
bioRxiv - Microbiology 2021Quote: ... PA) and AccuMap™ low pH protein digestion kit (with trypsin and lysC) and chymotrypsin (sequencing grade) were from Promega (Madison, WI). PreScisson protease was from GenScript (Piscataway ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lysates were prepared by addition of 0.3N hydrochloric acid then 450nM Tris (pH=8) and metabolites were analyzed using the Glutamine/Glutamate Glo Assay (Promega; J8021) per manufacturer’s instruction.
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Cancer Biology 2022Quote: PsiCHECK-2 vector (Promega) was employed to generate luciferase-based reporters for miRNA-target validation ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 µL RNasin (Promega), 250 µL TENT buffer (0.02 M Tris-HCl ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 mM MgCl2 (Promega), 0.5 µM of each H and L primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Trypsin (2 µg; Promega) was added to the samples before incubation at 37°C overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... phospho-Erk1/2 (Promega), FAK (C-20 ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples (about 20 μg of protein) were digested with 500 ng of trypsin (Promega) and peptides were analysed by an Ekspert nanoLC 42 nanoflow system (Eksigent Technologies ...
-
bioRxiv - Biochemistry 2021Quote: The kinase activity of the FLT3-ITD protein was measured by using ADP-Glo™ Kinase Assay Kit (Promega, Madison, Wisconsin, the US). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... The C terminus of rat Gβ1 was linked to peptide 86 subunit16,17 (also named as HiBiT, Promega) with a 15-amino acid polypeptide (GSSGGGGSGGGGSSG ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1X sample buffer (4X stock ...
-
bioRxiv - Cell Biology 2022Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1X sample buffer (4X stock ...
-
bioRxiv - Plant Biology 2023Quote: ... proteins were co-expressed using TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega) as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1 X sample buffer (4 X stock ...
-
bioRxiv - Cancer Biology 2024Quote: ... The estimation of protein concentration was done using BCA protein assay (Promega #PI-23222, PI-23224). Samples were diluted using 1 X sample buffer (4 X stock ...
-
bioRxiv - Immunology 2024Quote: ... The resuspended proteins were digested in trypsin/Lys-C mix (1:25 protease: protein ratio; Promega) for 16 hours at 37 °C in a thermomixer ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein G magnetic beads (Promega; G7471) were washed with PBS buffer and then added to the supernatant in a 1:10 volumetric ratio ...
-
bioRxiv - Microbiology 2021Quote: ... Protein was digested by trypsin (Promega) at a ratio of 1:50 (trypsin:protein ...
-
bioRxiv - Biophysics 2020Quote: ... Fusion Protein were purchased from Promega. Nickel superflow resin was purchased from Qiagen (Hilden ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested with trypsin (Promega) in 50 mM ABC overnight at 37 °C ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested with trypsin (Promega) at 37°C overnight ...