Labshake search
Citations for Promega :
151 - 200 of 5137 citations for Primary Human Melanocyte Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... the primary antibody was diluted in blocking buffer as follows: Anti-HaloTag (1:1000; Promega Corporation; G9281); anti-PHC1 antibody (1:500 ...
-
bioRxiv - Biophysics 2023Quote: ... prior to incubation with the primary anti-Halo-Tag antibody (Mouse monoclonal antibody, Promega, Cat. No.: G9211). For incubation with the primary anti-RBPJ antibody (Rat monoclonal antibody ...
-
bioRxiv - Molecular Biology 2020Quote: Human Genomic DNA was extracted from the blood using the Wizard Genomic DNA Purification kit (Promega) as per the instructions.
-
bioRxiv - Molecular Biology 2021Quote: Full-length human RNU6 sequence (110 nucleotides) was amplified by PCR and cloned into psiCHECK2 (Promega), downstream of Renilla luciferase ...
-
bioRxiv - Neuroscience 2021Quote: Genomic DNA (gDNA) was extracted from human frontal cortex using Wizard Genomic DNA Purification Kit (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Standards for quantification were created by serial dilution of pre-quantified BSC human male DNA (Promega). Amplification reactions were performed in duplicate using 96 well-plates using a CFX96 Touch Real-time PCR Detection System (Bio-Rad).
-
bioRxiv - Cancer Biology 2020Quote: The region of interest (750-850 bp) was PCR amplified from pooled male human DNA (Promega) and cloned into a STARRseq luciferase validation vector_ORI_empty plasmid (Addgene plasmid #99298 ...
-
bioRxiv - Molecular Biology 2020Quote: ... WT or mutant promoter of human Rpl28 gene was cloned into pGL-3-basic (Promega, E1751). The number is relative to transcriptional start site ...
-
bioRxiv - Bioengineering 2020Quote: ... and detected with anti-rabbit or anti-human HRP-conjugated secondary antibodies (Promega W4011 and W4031). Blots were developed using ECL (ThermoScientific 32106 ...
-
bioRxiv - Immunology 2023Quote: ... 100 μl of 5,000-fold diluted Peroxidase AffiniPure goat anti-human IgG (H+L) antibody (Promega) was added into each well and incubated for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human and murine NLRC5 and CXCL10 promoters were cloned into pGL3 basic luciferase reporter vector (Promega). All mutated plasmids were constructed from wild type plasmids by Fast Mutagenesis System (TransGen Biotech) ...
-
bioRxiv - Cell Biology 2023Quote: ... 10mM Ultrapure ATP and 0.7 μg of recombinant full-length human CDC7/DBF4 kinase (Promega, V5088). Reactions were incubated at 37 °C for 120 min and then terminated by freezing on dry ice before mass spectrometry.
-
bioRxiv - Neuroscience 2020Quote: ... the following primary antibodies were used at the indicated concentrations: 1:10’000 mouse anti-β3-Tubulin (Promega, G712A), rabbit anti-p-ERK T202/Y204 (CST ...
-
bioRxiv - Cancer Biology 2021Quote: Each enhancer or promoter region was amplified from human genomic DNA and cloned into pGL4.10 [luc2] (Promega) containing a SNP (rs718960 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 15 mg of His-Tev-HaloTag-(3C)-human γ-TuNA was coupled to Halo Magne beads (Promega). Xenopus laevis egg extract was prepared by standard methods28 ...
-
bioRxiv - Genomics 2023Quote: ... Primer efficiency was calculated using a 10-fold serial dilution of Human Mixed Genomic DNA (Promega G3041). For primer sequences and calculated efficiencies ...
-
bioRxiv - Molecular Biology 2023Quote: ... The secondary antibody was a horseradish peroxidase polyclonal goat anti-mouse (from 1:5,000 to 1:10,000, depending on the primary antibody; Promega, W4021). Proteins were detected with the ECL chemiluminescence reagent (GE Healthcare ...
-
bioRxiv - Genetics 2024Quote: ... and incubated with primary antibodies in a blocking buffer (1ξ PBS, 0.5% BSA) and then with alkaline phosphatase-conjugated secondary antibody (Promega). The color reaction was developed with NBT/BCIP solution (Nacalai Tesque).
-
bioRxiv - Cancer Biology 2021Quote: The upstream 376 bp region of the human LGALS1 transcriptional start site was cloned into the pGL4.23 (Promega) vector to generate the LGALS1 luciferase reporter gene (LGALS1 pGL4.23 ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Biophysics 2021Quote: ... Human Gβ with a C-terminal 15-amino-acid polypeptide linker followed by a HiBiT (peptide 86, Promega) and human Gγ were cloned into pFastBac vector ...
-
bioRxiv - Neuroscience 2024Quote: ... human CaV1.3 cDNA (accession number NM_001128840.2) was de-novo synthesized and assembled into a HaloTag vector (Promega G7721) using restriction cloning ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Cancer Biology 2020Quote: ... the blot was blocked with either 5% nonfat-milk or 5% BSA in TBST before addition of primary antibodies and followed with peroxidase-conjugated secondary antibody (Promega). Protein bands were detected using SuperSignal Chemiluminescent Substrate (Pierce ...
-
bioRxiv - Plant Biology 2020Quote: ... The target proteins were immunodecorated with primary antibodies and then incubated with horseradish peroxidase-conjugated anti-rabbit IgG antibodies (Catalogue number: W4011, Promega) at a dilution ratio of 1:20.000 ...
-
bioRxiv - Genetics 2021Quote: After the FISH protocol was complete gonads in PBS were incubated with primary antibodies diluted in PBS and 0.5 units/µl of RNasin (Promega N261A) at 4°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... before re-suspending in 50 μl flow buffer containing anti-Nluc polyclonal primary antibody raised in rabbit (Kindly gifted by Promega) at 1:100 dilution and incubated at room temperature for 1 hour ...
-
bioRxiv - Immunology 2020Quote: ... were used as primary antibodies and horseradish peroxidase (HRP)-conjugated secondary antibodies were from Promega (Rabbit W401B and Mouse W402B), and the substrate ECL was detected by Pierce ECL2 solution (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: Glucose uptake by cultured primary astrocytes was studied using a bioluminescent method with the Glucose Uptake Assay Kit (Promega, J1341) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... nitrocellulose membranes were blocked in 5% skimmed milk incubated with primary and secondary antibodies conjugated with alkaline phosphatase and developed with NBT/BCIP as substrates (Promega).
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were revealed using species-appropriate HRP-conjugated secondary antibodies (anti-rabbit or anti-mouse IgG (1:5000, Promega), or anti-guinea pig IgG (1:5000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Human β2AR was fused at its N-terminus to the ACP- or Halo7-tag protein (NEB and Promega, respectively) at the cDNA level ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Molecular Biology 2020Quote: ... The promoter area of human Rpl28 gene was cloned at HindIII/NcoI site of the pGL3-basic (Promega, E1751) to make pGL3-reporters ...
-
bioRxiv - Genomics 2022Quote: Approximately 500-bp regions of DNA containing rs80282103 and rs11154336 were amplified from purified human genomic DNA (Promega, #G1521) by PCR using engineered restriction sites to allow directional cloning into the multiple cloning region of the pGL4.23[luc2/minP] luciferase reporter vector (Promega ...
-
bioRxiv - Neuroscience 2021Quote: We constructed luciferase reporter plasmids by cloning an ∼900 bp region containing human 1b30 into the pGL4.24 vector (Promega) upstream of the minP ...
-
bioRxiv - Biophysics 2022Quote: ... pHalo-SMARCA4 expresses human SMARCA4 with HaloTag fused to the N-terminus under a CMVd1 promoter (Promega ORF FHC12075). pHalo-MED26 expresses human MED26 fused with a HaloTag at the N-terminus and was a kind gift from Joan Conaway’s lab ...
-
bioRxiv - Cancer Biology 2022Quote: ... a 3kb region of the promoter containing HIC1 binding sites was amplified by PCR from human genomic DNA and cloned into the pGl4.26-luc vector (Promega); primers are listed in supplementary Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The human Gβ1 with a C-terminal 15-amino acid polypeptide linker was followed by a HiBiT (peptide 86, Promega), and the scFv16 was modified with an N-terminal GP67 signaling peptide and a C-terminal 8× histidine tag ...
-
bioRxiv - Microbiology 2023Quote: ... After 30 minutes of incubation at 37°C in 5% CO2 we added 50,000 ADCC-RL cells (Jurkat cell line expressing luciferase gene under the control of the NFAT response element and stably expressing human FcγRIIIa V158; Promega) in 50 µl RPMI 1640 medium with 6% low-IgG serum (Promega) ...
-
bioRxiv - Neuroscience 2023Quote: ... We amplified the regions from C57Bl/6 tail snip DNA or from human male genomic DNA (Promega catalog # G1471) using FastPhusion 2x Master Mix (Thermo Fisher catalog # F548L) ...
-
bioRxiv - Cell Biology 2023Quote: ... TTBK2 KO cell lines were seeded on glass coverslips (Matrigel-coated for hPSCs) and the next day transfected with 0.5μg TTBK1-HaloTag® human ORF in pFN21A (FHC12512, Promega) or pglap1-TTBK2 (“GFP-TTBK2” ...
-
bioRxiv - Genomics 2023Quote: ... Reference allele enhancer sequences for hZRS and hs737 were obtained via PCR cloning from human genomic DNA (Promega, G304A). Primers used for each enhancer sequence are outlined in Table S2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cell viability (Cell Titer Blue, Promega), cell cycle (Vybrant DyeCycle Stain ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...